Incidental Mutation 'R8804:Tas2r140'
ID671915
Institutional Source Beutler Lab
Gene Symbol Tas2r140
Ensembl Gene ENSMUSG00000071147
Gene Nametaste receptor, type 2, member 140
SynonymsTas2r40, TRB5, T2R40, TRB3, mTRB3, Tas2r13, mt2r64
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.049) question?
Stock #R8804 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location133054817-133055816 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 133055363 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 144 (N144I)
Ref Sequence ENSEMBL: ENSMUSP00000093040 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095391]
Predicted Effect probably damaging
Transcript: ENSMUST00000095391
AA Change: N144I

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000093040
Gene: ENSMUSG00000071147
AA Change: N144I

DomainStartEndE-ValueType
Pfam:TAS2R 1 301 6.7e-86 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product belongs to the family of candidate taste receptors that are members of the G-protein-coupled receptor superfamily. These proteins are specifically expressed in the taste receptor cells of the tongue and palate epithelia. They are organized in the genome in clusters and are genetically linked to loci that influence bitter perception in mice and humans. In functional expression studies, they respond to bitter tastants. This gene maps to the taste receptor gene cluster on chromosome 12p13. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700064H15Rik T C 3: 19,628,656 probably benign Het
Adamts1 A G 16: 85,802,412 F100S probably damaging Het
Adamts5 A G 16: 85,869,912 probably benign Het
Adgrb2 T A 4: 130,005,419 W309R probably damaging Het
Adgrl2 A T 3: 148,847,016 V617E probably damaging Het
Akt1 T C 12: 112,658,607 E169G probably damaging Het
Arhgap40 A G 2: 158,547,706 T600A probably benign Het
B4galt3 C T 1: 171,276,374 H395Y probably benign Het
BC024139 T G 15: 76,124,084 T376P possibly damaging Het
Bin3 A G 14: 70,123,847 R22G probably damaging Het
Cadps2 A T 6: 23,496,806 I480N probably damaging Het
Camsap3 A G 8: 3,602,624 T401A probably benign Het
Cdhr5 T C 7: 141,269,407 T747A probably benign Het
Chn2 A G 6: 54,273,076 I193V probably benign Het
Clca3b T C 3: 144,839,137 N363S probably benign Het
Clec7a T C 6: 129,465,555 T125A probably benign Het
Cys1 A T 12: 24,668,611 L81Q unknown Het
Dcbld2 G A 16: 58,461,049 probably benign Het
Ddx60 T A 8: 61,958,606 D497E probably benign Het
Dnah2 T C 11: 69,465,685 I2117V probably benign Het
Dnah6 G A 6: 73,065,773 S3274F probably benign Het
Dock9 A T 14: 121,605,183 I1225N probably damaging Het
Egfr A G 11: 16,869,339 T290A probably benign Het
Elmod2 T A 8: 83,319,521 K142N probably benign Het
Ephx2 T C 14: 66,087,020 T441A probably benign Het
Fam234a A G 17: 26,216,557 probably benign Het
Fer1l4 C A 2: 156,051,994 E102D probably benign Het
Fermt3 A G 19: 7,014,326 probably benign Het
Fgd5 C T 6: 91,987,526 R247C probably benign Het
Gm14443 G A 2: 175,169,859 H265Y probably damaging Het
Gm8251 T C 1: 44,056,649 N1763S probably benign Het
Gykl1 A G 18: 52,694,536 D272G probably benign Het
Hip1r T C 5: 124,001,512 S952P possibly damaging Het
Hmcn2 A G 2: 31,425,381 N3714S probably benign Het
Hrasls T A 16: 29,220,453 V95E probably benign Het
Ighv1-36 G T 12: 114,879,961 T93K probably benign Het
Igsf10 T G 3: 59,336,455 T153P probably damaging Het
Kif13b T C 14: 64,750,342 C773R probably damaging Het
Lipf T A 19: 33,964,798 Y43N probably damaging Het
Mlh1 T C 9: 111,264,904 D90G probably damaging Het
Msh5 A T 17: 35,032,854 I410K probably benign Het
Mylk3 T C 8: 85,359,245 D220G probably benign Het
Ncdn G A 4: 126,750,105 A308V probably benign Het
Nup153 A G 13: 46,687,159 V991A probably benign Het
Nup188 T A 2: 30,330,879 H960Q probably benign Het
Parp4 G T 14: 56,616,443 E839* probably null Het
Pfas T C 11: 68,991,082 N30D Het
Pitpnc1 T A 11: 107,212,605 N223Y probably damaging Het
Plod1 C T 4: 147,913,321 V644I probably damaging Het
Pou2f1 T C 1: 165,880,470 T548A unknown Het
Psg20 A T 7: 18,682,659 N177K possibly damaging Het
Psmb8 T A 17: 34,200,251 I173N probably damaging Het
Rimkla G A 4: 119,468,076 Q379* probably null Het
Rnasel G T 1: 153,753,915 G59V probably damaging Het
Rptn A T 3: 93,395,843 D161V probably damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,926 probably benign Het
Scrt1 C A 15: 76,519,211 C193F unknown Het
Sdk2 G T 11: 113,873,152 Y269* probably null Het
Sfxn2 G C 19: 46,585,804 probably benign Het
Slc17a4 G T 13: 23,903,262 T264K probably benign Het
Slfn8 T A 11: 83,016,813 Q301H possibly damaging Het
Sntb1 G A 15: 55,792,127 S231F probably benign Het
Spag17 T A 3: 99,967,190 S137T probably benign Het
Srd5a2 A T 17: 74,047,634 V65E possibly damaging Het
Stk11ip A G 1: 75,535,256 H967R probably benign Het
Sun1 A G 5: 139,231,165 T320A probably benign Het
Svep1 A G 4: 58,206,043 S112P possibly damaging Het
Tacc2 T C 7: 130,692,963 L15P probably benign Het
Thpo T A 16: 20,725,957 R174S probably damaging Het
Tnik A T 3: 28,594,053 Q418L unknown Het
Tnr A T 1: 159,858,312 Q371L probably benign Het
Tulp2 G A 7: 45,520,974 R439Q probably damaging Het
Uchl4 G T 9: 64,235,324 W29L probably damaging Het
Vrk3 T A 7: 44,757,846 C80* probably null Het
Washc4 T C 10: 83,572,151 L540P probably damaging Het
Wscd1 T C 11: 71,784,335 F356S probably damaging Het
Wwc1 A T 11: 35,883,317 M372K probably benign Het
Zfhx2 A G 14: 55,074,734 F168L probably benign Het
Zfp28 A G 7: 6,390,400 D175G probably damaging Het
Other mutations in Tas2r140
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0244:Tas2r140 UTSW 6 133055327 missense possibly damaging 0.46
R0666:Tas2r140 UTSW 6 133055442 missense probably benign 0.22
R1174:Tas2r140 UTSW 6 133054871 missense probably benign 0.27
R1237:Tas2r140 UTSW 6 133055208 missense probably benign 0.04
R1553:Tas2r140 UTSW 6 133055508 missense probably damaging 0.99
R2030:Tas2r140 UTSW 6 133055250 missense probably benign 0.23
R3123:Tas2r140 UTSW 6 133055241 missense probably benign 0.05
R3124:Tas2r140 UTSW 6 133055241 missense probably benign 0.05
R4233:Tas2r140 UTSW 6 133054952 missense probably damaging 1.00
R4234:Tas2r140 UTSW 6 133054952 missense probably damaging 1.00
R4236:Tas2r140 UTSW 6 133054952 missense probably damaging 1.00
R4525:Tas2r140 UTSW 6 133055244 missense possibly damaging 0.66
R4803:Tas2r140 UTSW 6 133055780 missense possibly damaging 0.77
R4840:Tas2r140 UTSW 6 133055565 missense probably benign 0.01
R5317:Tas2r140 UTSW 6 133055580 missense probably benign 0.06
R5937:Tas2r140 UTSW 6 133055273 missense probably benign 0.01
R6142:Tas2r140 UTSW 6 133055735 missense probably damaging 1.00
R7127:Tas2r140 UTSW 6 133054959 missense possibly damaging 0.62
R7143:Tas2r140 UTSW 6 133055519 missense probably benign 0.00
R7178:Tas2r140 UTSW 6 133055660 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCATGTTCTTCAGATGAGTCC -3'
(R):5'- TTGTGTGGTCACTACTCACAG -3'

Sequencing Primer
(F):5'- TCTTCAGATGAGTCCATAGTGAGAAG -3'
(R):5'- CACAGTTTTATTCACATCTGAGCTG -3'
Posted On2021-04-30