Incidental Mutation 'R8804:Mlh1'
ID671928
Institutional Source Beutler Lab
Gene Symbol Mlh1
Ensembl Gene ENSMUSG00000032498
Gene NamemutL homolog 1
Synonymscolon cancer, nonpolyposis type 2, 1110035C23Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8804 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location111228228-111271791 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 111264904 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 90 (D90G)
Ref Sequence ENSEMBL: ENSMUSP00000035079 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035079] [ENSMUST00000135218] [ENSMUST00000135695]
Predicted Effect probably damaging
Transcript: ENSMUST00000035079
AA Change: D90G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000035079
Gene: ENSMUSG00000032498
AA Change: D90G

DomainStartEndE-ValueType
HATPase_c 23 158 4.57e-1 SMART
DNA_mis_repair 216 335 1.08e-44 SMART
low complexity region 363 375 N/A INTRINSIC
low complexity region 429 454 N/A INTRINSIC
Pfam:Mlh1_C 504 760 8.3e-100 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000135218
Predicted Effect probably benign
Transcript: ENSMUST00000135695
SMART Domains Protein: ENSMUSP00000119170
Gene: ENSMUSG00000032498

DomainStartEndE-ValueType
Blast:HATPase_c 1 53 8e-33 BLAST
SCOP:d1b63a2 1 75 7e-22 SMART
PDB:4P7A|A 1 76 2e-47 PDB
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was identified as a locus frequently mutated in hereditary nonpolyposis colon cancer (HNPCC). It is a human homolog of the E. coli DNA mismatch repair gene mutL, consistent with the characteristic alterations in microsatellite sequences (RER+phenotype) found in HNPCC. Alternative splicing results in multiple transcript variants encoding distinct isoforms. Additional transcript variants have been described, but their full-length natures have not been determined.[provided by RefSeq, Nov 2009]
PHENOTYPE: Homozygotes for targeted null mutations exhibit reduced pairing in meiotic prophase I and produce no mature germ cells. Mutants also display increased microsatellite instability and a predisposition for developing intestinal and other tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700064H15Rik T C 3: 19,628,656 probably benign Het
Adamts1 A G 16: 85,802,412 F100S probably damaging Het
Adamts5 A G 16: 85,869,912 probably benign Het
Adgrb2 T A 4: 130,005,419 W309R probably damaging Het
Adgrl2 A T 3: 148,847,016 V617E probably damaging Het
Akt1 T C 12: 112,658,607 E169G probably damaging Het
Arhgap40 A G 2: 158,547,706 T600A probably benign Het
B4galt3 C T 1: 171,276,374 H395Y probably benign Het
BC024139 T G 15: 76,124,084 T376P possibly damaging Het
Bin3 A G 14: 70,123,847 R22G probably damaging Het
Cadps2 A T 6: 23,496,806 I480N probably damaging Het
Camsap3 A G 8: 3,602,624 T401A probably benign Het
Cdhr5 T C 7: 141,269,407 T747A probably benign Het
Chn2 A G 6: 54,273,076 I193V probably benign Het
Clca3b T C 3: 144,839,137 N363S probably benign Het
Clec7a T C 6: 129,465,555 T125A probably benign Het
Cys1 A T 12: 24,668,611 L81Q unknown Het
Dcbld2 G A 16: 58,461,049 probably benign Het
Ddx60 T A 8: 61,958,606 D497E probably benign Het
Dnah2 T C 11: 69,465,685 I2117V probably benign Het
Dnah6 G A 6: 73,065,773 S3274F probably benign Het
Dock9 A T 14: 121,605,183 I1225N probably damaging Het
Egfr A G 11: 16,869,339 T290A probably benign Het
Elmod2 T A 8: 83,319,521 K142N probably benign Het
Ephx2 T C 14: 66,087,020 T441A probably benign Het
Fam234a A G 17: 26,216,557 probably benign Het
Fer1l4 C A 2: 156,051,994 E102D probably benign Het
Fermt3 A G 19: 7,014,326 probably benign Het
Fgd5 C T 6: 91,987,526 R247C probably benign Het
Gm14443 G A 2: 175,169,859 H265Y probably damaging Het
Gm8251 T C 1: 44,056,649 N1763S probably benign Het
Gykl1 A G 18: 52,694,536 D272G probably benign Het
Hip1r T C 5: 124,001,512 S952P possibly damaging Het
Hmcn2 A G 2: 31,425,381 N3714S probably benign Het
Hrasls T A 16: 29,220,453 V95E probably benign Het
Ighv1-36 G T 12: 114,879,961 T93K probably benign Het
Igsf10 T G 3: 59,336,455 T153P probably damaging Het
Kif13b T C 14: 64,750,342 C773R probably damaging Het
Lipf T A 19: 33,964,798 Y43N probably damaging Het
Msh5 A T 17: 35,032,854 I410K probably benign Het
Mylk3 T C 8: 85,359,245 D220G probably benign Het
Ncdn G A 4: 126,750,105 A308V probably benign Het
Nup153 A G 13: 46,687,159 V991A probably benign Het
Nup188 T A 2: 30,330,879 H960Q probably benign Het
Parp4 G T 14: 56,616,443 E839* probably null Het
Pfas T C 11: 68,991,082 N30D Het
Pitpnc1 T A 11: 107,212,605 N223Y probably damaging Het
Plod1 C T 4: 147,913,321 V644I probably damaging Het
Pou2f1 T C 1: 165,880,470 T548A unknown Het
Psg20 A T 7: 18,682,659 N177K possibly damaging Het
Psmb8 T A 17: 34,200,251 I173N probably damaging Het
Rimkla G A 4: 119,468,076 Q379* probably null Het
Rnasel G T 1: 153,753,915 G59V probably damaging Het
Rptn A T 3: 93,395,843 D161V probably damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,926 probably benign Het
Scrt1 C A 15: 76,519,211 C193F unknown Het
Sdk2 G T 11: 113,873,152 Y269* probably null Het
Sfxn2 G C 19: 46,585,804 probably benign Het
Slc17a4 G T 13: 23,903,262 T264K probably benign Het
Slfn8 T A 11: 83,016,813 Q301H possibly damaging Het
Sntb1 G A 15: 55,792,127 S231F probably benign Het
Spag17 T A 3: 99,967,190 S137T probably benign Het
Srd5a2 A T 17: 74,047,634 V65E possibly damaging Het
Stk11ip A G 1: 75,535,256 H967R probably benign Het
Sun1 A G 5: 139,231,165 T320A probably benign Het
Svep1 A G 4: 58,206,043 S112P possibly damaging Het
Tacc2 T C 7: 130,692,963 L15P probably benign Het
Tas2r140 T A 6: 133,055,363 N144I probably damaging Het
Thpo T A 16: 20,725,957 R174S probably damaging Het
Tnik A T 3: 28,594,053 Q418L unknown Het
Tnr A T 1: 159,858,312 Q371L probably benign Het
Tulp2 G A 7: 45,520,974 R439Q probably damaging Het
Uchl4 G T 9: 64,235,324 W29L probably damaging Het
Vrk3 T A 7: 44,757,846 C80* probably null Het
Washc4 T C 10: 83,572,151 L540P probably damaging Het
Wscd1 T C 11: 71,784,335 F356S probably damaging Het
Wwc1 A T 11: 35,883,317 M372K probably benign Het
Zfhx2 A G 14: 55,074,734 F168L probably benign Het
Zfp28 A G 7: 6,390,400 D175G probably damaging Het
Other mutations in Mlh1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01306:Mlh1 APN 9 111252912 missense possibly damaging 0.84
IGL02530:Mlh1 APN 9 111229875 missense probably benign 0.09
IGL02811:Mlh1 APN 9 111271514 missense probably benign 0.04
IGL02892:Mlh1 APN 9 111252969 missense probably benign 0.00
IGL03394:Mlh1 APN 9 111268243 missense probably damaging 1.00
andalusia UTSW 9 111271410 makesense probably null
andalusia2 UTSW 9 111271523 start codon destroyed probably null 0.93
andalusia3 UTSW 9 111229838 critical splice donor site probably null
ANU23:Mlh1 UTSW 9 111252912 missense possibly damaging 0.84
PIT4495001:Mlh1 UTSW 9 111247260 missense probably benign 0.00
R0496:Mlh1 UTSW 9 111241556 missense probably benign
R0723:Mlh1 UTSW 9 111271472 missense probably damaging 1.00
R1395:Mlh1 UTSW 9 111247377 missense probably damaging 1.00
R1694:Mlh1 UTSW 9 111228475 missense probably damaging 1.00
R1762:Mlh1 UTSW 9 111229929 missense probably damaging 1.00
R1865:Mlh1 UTSW 9 111257024 intron probably benign
R1885:Mlh1 UTSW 9 111258556 missense probably benign 0.18
R1992:Mlh1 UTSW 9 111228563 missense probably damaging 0.96
R2186:Mlh1 UTSW 9 111258566 unclassified probably benign
R2680:Mlh1 UTSW 9 111236017 critical splice acceptor site probably null
R4693:Mlh1 UTSW 9 111255658 missense probably damaging 1.00
R4784:Mlh1 UTSW 9 111239798 missense probably benign
R5007:Mlh1 UTSW 9 111271410 makesense probably null
R5130:Mlh1 UTSW 9 111229838 critical splice donor site probably null
R5166:Mlh1 UTSW 9 111241513 missense probably benign 0.04
R5265:Mlh1 UTSW 9 111271523 start codon destroyed probably null 0.93
R5481:Mlh1 UTSW 9 111229837 splice site probably null
R5483:Mlh1 UTSW 9 111231058 missense possibly damaging 0.82
R5602:Mlh1 UTSW 9 111252878 missense probably damaging 0.97
R5658:Mlh1 UTSW 9 111247380 missense probably damaging 0.99
R5890:Mlh1 UTSW 9 111228495 missense possibly damaging 0.88
R6810:Mlh1 UTSW 9 111241558 missense possibly damaging 0.52
R7607:Mlh1 UTSW 9 111229890 missense probably damaging 1.00
R7753:Mlh1 UTSW 9 111252863 critical splice donor site probably null
R7894:Mlh1 UTSW 9 111230077 splice site probably null
R7912:Mlh1 UTSW 9 111261513 missense possibly damaging 0.69
R7995:Mlh1 UTSW 9 111235921 missense probably damaging 1.00
R8097:Mlh1 UTSW 9 111256092 critical splice donor site probably null
R8280:Mlh1 UTSW 9 111249218 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GAATTTCTCAGTCACGGAAAGC -3'
(R):5'- CCCAGTAAAGTGAAAATCTAGGTCG -3'

Sequencing Primer
(F):5'- CTCAGTCACGGAAAGCTAAATTTG -3'
(R):5'- GGAAGTTGGTACTAATTTAGACCTCC -3'
Posted On2021-04-30