Incidental Mutation 'R8804:Slfn8'
ID 671935
Institutional Source Beutler Lab
Gene Symbol Slfn8
Ensembl Gene ENSMUSG00000035208
Gene Name schlafen 8
Synonyms
MMRRC Submission 068641-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.081) question?
Stock # R8804 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 82892984-82911636 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 82907639 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Histidine at position 301 (Q301H)
Ref Sequence ENSEMBL: ENSMUSP00000040060 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038141] [ENSMUST00000092838] [ENSMUST00000108152] [ENSMUST00000130822] [ENSMUST00000215239]
AlphaFold B1ARD8
Predicted Effect possibly damaging
Transcript: ENSMUST00000038141
AA Change: Q301H

PolyPhen 2 Score 0.939 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000040060
Gene: ENSMUSG00000035208
AA Change: Q301H

DomainStartEndE-ValueType
Pfam:AAA_4 205 343 1.6e-18 PFAM
Pfam:DUF2075 592 766 5.8e-11 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000092838
AA Change: Q301H

PolyPhen 2 Score 0.939 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000090513
Gene: ENSMUSG00000035208
AA Change: Q301H

DomainStartEndE-ValueType
Pfam:AlbA_2 205 341 1.4e-17 PFAM
Pfam:DUF2075 592 767 2.2e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108152
AA Change: Q301H

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000103787
Gene: ENSMUSG00000035208
AA Change: Q301H

DomainStartEndE-ValueType
Pfam:AAA_4 205 343 4.1e-19 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000130822
AA Change: Q301H

PolyPhen 2 Score 0.939 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000114417
Gene: ENSMUSG00000035208
AA Change: Q301H

DomainStartEndE-ValueType
Pfam:AAA_4 205 343 3.7e-19 PFAM
SCOP:d1ly1a_ 593 625 4e-3 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000121831
Gene: ENSMUSG00000035208
AA Change: Q122H

DomainStartEndE-ValueType
Pfam:AlbA_2 27 163 1.8e-15 PFAM
SCOP:d1ly1a_ 370 402 2e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000215239
AA Change: Q301H

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 98% (79/81)
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700064H15Rik T C 3: 19,682,820 (GRCm39) probably benign Het
Adamts1 A G 16: 85,599,300 (GRCm39) F100S probably damaging Het
Adamts5 A G 16: 85,666,800 (GRCm39) probably benign Het
Adgrb2 T A 4: 129,899,212 (GRCm39) W309R probably damaging Het
Adgrl2 A T 3: 148,552,652 (GRCm39) V617E probably damaging Het
Akt1 T C 12: 112,625,041 (GRCm39) E169G probably damaging Het
Arhgap40 A G 2: 158,389,626 (GRCm39) T600A probably benign Het
B4galt3 C T 1: 171,103,947 (GRCm39) H395Y probably benign Het
BC024139 T G 15: 76,008,284 (GRCm39) T376P possibly damaging Het
Bin3 A G 14: 70,361,296 (GRCm39) R22G probably damaging Het
Cadps2 A T 6: 23,496,805 (GRCm39) I480N probably damaging Het
Camsap3 A G 8: 3,652,624 (GRCm39) T401A probably benign Het
Ccdc168 T C 1: 44,095,809 (GRCm39) N1763S probably benign Het
Cdhr5 T C 7: 140,849,320 (GRCm39) T747A probably benign Het
Chn2 A G 6: 54,250,061 (GRCm39) I193V probably benign Het
Clca3b T C 3: 144,544,898 (GRCm39) N363S probably benign Het
Clec7a T C 6: 129,442,518 (GRCm39) T125A probably benign Het
Cys1 A T 12: 24,718,610 (GRCm39) L81Q unknown Het
Dcbld2 G A 16: 58,281,412 (GRCm39) probably benign Het
Ddx60 T A 8: 62,411,640 (GRCm39) D497E probably benign Het
Dnah2 T C 11: 69,356,511 (GRCm39) I2117V probably benign Het
Dnah6 G A 6: 73,042,756 (GRCm39) S3274F probably benign Het
Dock9 A T 14: 121,842,595 (GRCm39) I1225N probably damaging Het
Egfr A G 11: 16,819,339 (GRCm39) T290A probably benign Het
Elmod2 T A 8: 84,046,150 (GRCm39) K142N probably benign Het
Ephx2 T C 14: 66,324,469 (GRCm39) T441A probably benign Het
Fam234a A G 17: 26,435,531 (GRCm39) probably benign Het
Fer1l4 C A 2: 155,893,914 (GRCm39) E102D probably benign Het
Fermt3 A G 19: 6,991,694 (GRCm39) probably benign Het
Fgd5 C T 6: 91,964,507 (GRCm39) R247C probably benign Het
Gm14443 G A 2: 175,011,652 (GRCm39) H265Y probably damaging Het
Gykl1 A G 18: 52,827,608 (GRCm39) D272G probably benign Het
Hip1r T C 5: 124,139,575 (GRCm39) S952P possibly damaging Het
Hmcn2 A G 2: 31,315,393 (GRCm39) N3714S probably benign Het
Ighv1-36 G T 12: 114,843,581 (GRCm39) T93K probably benign Het
Igsf10 T G 3: 59,243,876 (GRCm39) T153P probably damaging Het
Kif13b T C 14: 64,987,791 (GRCm39) C773R probably damaging Het
Lipf T A 19: 33,942,198 (GRCm39) Y43N probably damaging Het
Mlh1 T C 9: 111,093,972 (GRCm39) D90G probably damaging Het
Msh5 A T 17: 35,251,830 (GRCm39) I410K probably benign Het
Mylk3 T C 8: 86,085,874 (GRCm39) D220G probably benign Het
Ncdn G A 4: 126,643,898 (GRCm39) A308V probably benign Het
Nfu1 T A 6: 86,993,414 (GRCm39) probably benign Het
Nup153 A G 13: 46,840,635 (GRCm39) V991A probably benign Het
Nup188 T A 2: 30,220,891 (GRCm39) H960Q probably benign Het
Parp4 G T 14: 56,853,900 (GRCm39) E839* probably null Het
Pfas T C 11: 68,881,908 (GRCm39) N30D Het
Pitpnc1 T A 11: 107,103,431 (GRCm39) N223Y probably damaging Het
Plaat1 T A 16: 29,039,205 (GRCm39) V95E probably benign Het
Plod1 C T 4: 147,997,778 (GRCm39) V644I probably damaging Het
Pou2f1 T C 1: 165,708,039 (GRCm39) T548A unknown Het
Psg20 A T 7: 18,416,584 (GRCm39) N177K possibly damaging Het
Psmb8 T A 17: 34,419,225 (GRCm39) I173N probably damaging Het
Rimkla G A 4: 119,325,273 (GRCm39) Q379* probably null Het
Rnasel G T 1: 153,629,661 (GRCm39) G59V probably damaging Het
Rptn A T 3: 93,303,150 (GRCm39) D161V probably damaging Het
Scrt1 C A 15: 76,403,411 (GRCm39) C193F unknown Het
Sdk2 G T 11: 113,763,978 (GRCm39) Y269* probably null Het
Sfxn2 G C 19: 46,574,243 (GRCm39) probably benign Het
Slc17a4 G T 13: 24,087,245 (GRCm39) T264K probably benign Het
Sntb1 G A 15: 55,655,523 (GRCm39) S231F probably benign Het
Spag17 T A 3: 99,874,506 (GRCm39) S137T probably benign Het
Srd5a2 A T 17: 74,354,629 (GRCm39) V65E possibly damaging Het
Stk11ip A G 1: 75,511,900 (GRCm39) H967R probably benign Het
Sun1 A G 5: 139,216,920 (GRCm39) T320A probably benign Het
Svep1 A G 4: 58,206,043 (GRCm39) S112P possibly damaging Het
Tacc2 T C 7: 130,294,693 (GRCm39) L15P probably benign Het
Tas2r140 T A 6: 133,032,326 (GRCm39) N144I probably damaging Het
Thpo T A 16: 20,544,707 (GRCm39) R174S probably damaging Het
Tnik A T 3: 28,648,202 (GRCm39) Q418L unknown Het
Tnr A T 1: 159,685,882 (GRCm39) Q371L probably benign Het
Tulp2 G A 7: 45,170,398 (GRCm39) R439Q probably damaging Het
Uchl4 G T 9: 64,142,606 (GRCm39) W29L probably damaging Het
Vrk3 T A 7: 44,407,270 (GRCm39) C80* probably null Het
Washc4 T C 10: 83,408,015 (GRCm39) L540P probably damaging Het
Wscd1 T C 11: 71,675,161 (GRCm39) F356S probably damaging Het
Wwc1 A T 11: 35,774,144 (GRCm39) M372K probably benign Het
Zfhx2 A G 14: 55,312,191 (GRCm39) F168L probably benign Het
Zfp28 A G 7: 6,393,399 (GRCm39) D175G probably damaging Het
Other mutations in Slfn8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00500:Slfn8 APN 11 82,904,310 (GRCm39) missense possibly damaging 0.75
IGL01418:Slfn8 APN 11 82,895,462 (GRCm39) missense probably damaging 1.00
IGL01620:Slfn8 APN 11 82,895,059 (GRCm39) nonsense probably null
IGL01875:Slfn8 APN 11 82,894,905 (GRCm39) missense probably benign 0.30
IGL01896:Slfn8 APN 11 82,894,522 (GRCm39) missense probably damaging 1.00
IGL01929:Slfn8 APN 11 82,894,231 (GRCm39) nonsense probably null
IGL02111:Slfn8 APN 11 82,895,324 (GRCm39) missense probably damaging 1.00
IGL02136:Slfn8 APN 11 82,894,291 (GRCm39) nonsense probably null
IGL02165:Slfn8 APN 11 82,908,022 (GRCm39) missense probably benign 0.00
IGL02645:Slfn8 APN 11 82,894,380 (GRCm39) missense possibly damaging 0.82
IGL02682:Slfn8 APN 11 82,894,517 (GRCm39) missense probably damaging 1.00
IGL02689:Slfn8 APN 11 82,907,934 (GRCm39) missense probably damaging 1.00
IGL02948:Slfn8 APN 11 82,894,078 (GRCm39) missense probably damaging 0.99
IGL03037:Slfn8 APN 11 82,894,078 (GRCm39) missense probably damaging 0.99
IGL03185:Slfn8 APN 11 82,908,333 (GRCm39) missense probably benign 0.01
IGL03243:Slfn8 APN 11 82,894,533 (GRCm39) missense probably damaging 1.00
IGL03286:Slfn8 APN 11 82,904,294 (GRCm39) missense probably damaging 0.99
seven_dwarfs UTSW 11 82,894,160 (GRCm39) missense probably benign 0.09
vanwinkle UTSW 11 82,908,219 (GRCm39) missense probably damaging 1.00
R0295:Slfn8 UTSW 11 82,894,169 (GRCm39) nonsense probably null
R0368:Slfn8 UTSW 11 82,907,958 (GRCm39) missense probably damaging 1.00
R0382:Slfn8 UTSW 11 82,895,382 (GRCm39) missense probably damaging 1.00
R0655:Slfn8 UTSW 11 82,894,647 (GRCm39) missense probably benign 0.35
R0894:Slfn8 UTSW 11 82,894,407 (GRCm39) missense probably benign 0.07
R1006:Slfn8 UTSW 11 82,894,337 (GRCm39) missense possibly damaging 0.69
R1181:Slfn8 UTSW 11 82,907,571 (GRCm39) missense probably benign 0.19
R1187:Slfn8 UTSW 11 82,894,314 (GRCm39) missense probably damaging 1.00
R1501:Slfn8 UTSW 11 82,894,006 (GRCm39) missense probably damaging 0.99
R1646:Slfn8 UTSW 11 82,907,712 (GRCm39) missense probably damaging 1.00
R1909:Slfn8 UTSW 11 82,894,447 (GRCm39) nonsense probably null
R2005:Slfn8 UTSW 11 82,894,976 (GRCm39) missense probably damaging 1.00
R2363:Slfn8 UTSW 11 82,894,920 (GRCm39) missense probably damaging 1.00
R3780:Slfn8 UTSW 11 82,908,280 (GRCm39) missense probably benign 0.13
R3890:Slfn8 UTSW 11 82,895,270 (GRCm39) missense possibly damaging 0.68
R3917:Slfn8 UTSW 11 82,907,819 (GRCm39) nonsense probably null
R4559:Slfn8 UTSW 11 82,895,570 (GRCm39) missense probably damaging 1.00
R4684:Slfn8 UTSW 11 82,908,332 (GRCm39) missense probably benign 0.10
R4767:Slfn8 UTSW 11 82,894,023 (GRCm39) missense possibly damaging 0.66
R4773:Slfn8 UTSW 11 82,908,219 (GRCm39) missense probably damaging 1.00
R4859:Slfn8 UTSW 11 82,908,540 (GRCm39) start codon destroyed probably null 0.99
R4916:Slfn8 UTSW 11 82,907,704 (GRCm39) missense probably damaging 1.00
R4939:Slfn8 UTSW 11 82,894,111 (GRCm39) missense probably benign 0.01
R5107:Slfn8 UTSW 11 82,907,976 (GRCm39) missense probably damaging 0.99
R5130:Slfn8 UTSW 11 82,894,647 (GRCm39) missense probably benign 0.35
R5165:Slfn8 UTSW 11 82,907,953 (GRCm39) missense probably damaging 0.99
R5238:Slfn8 UTSW 11 82,904,214 (GRCm39) missense probably damaging 0.96
R5282:Slfn8 UTSW 11 82,908,550 (GRCm39) critical splice acceptor site probably null
R5311:Slfn8 UTSW 11 82,894,910 (GRCm39) missense probably damaging 1.00
R5499:Slfn8 UTSW 11 82,895,042 (GRCm39) missense probably damaging 0.99
R5617:Slfn8 UTSW 11 82,895,547 (GRCm39) missense probably benign 0.01
R5782:Slfn8 UTSW 11 82,907,867 (GRCm39) missense probably damaging 0.98
R5823:Slfn8 UTSW 11 82,907,562 (GRCm39) missense probably benign 0.01
R5886:Slfn8 UTSW 11 82,894,160 (GRCm39) missense probably benign 0.09
R5933:Slfn8 UTSW 11 82,894,161 (GRCm39) missense probably benign 0.00
R6151:Slfn8 UTSW 11 82,908,147 (GRCm39) missense probably damaging 1.00
R6163:Slfn8 UTSW 11 82,894,690 (GRCm39) makesense probably null
R6191:Slfn8 UTSW 11 82,907,626 (GRCm39) missense possibly damaging 0.72
R6419:Slfn8 UTSW 11 82,894,881 (GRCm39) splice site probably null
R6925:Slfn8 UTSW 11 82,904,243 (GRCm39) nonsense probably null
R7065:Slfn8 UTSW 11 82,907,794 (GRCm39) missense probably benign 0.01
R7380:Slfn8 UTSW 11 82,894,566 (GRCm39) missense not run
R7414:Slfn8 UTSW 11 82,907,618 (GRCm39) nonsense probably null
R7819:Slfn8 UTSW 11 82,895,081 (GRCm39) missense probably damaging 1.00
R8425:Slfn8 UTSW 11 82,895,441 (GRCm39) missense possibly damaging 0.80
R8517:Slfn8 UTSW 11 82,894,968 (GRCm39) missense possibly damaging 0.68
R8814:Slfn8 UTSW 11 82,907,505 (GRCm39) missense possibly damaging 0.95
R9069:Slfn8 UTSW 11 82,907,902 (GRCm39) missense probably damaging 1.00
R9233:Slfn8 UTSW 11 82,894,422 (GRCm39) missense probably damaging 1.00
R9457:Slfn8 UTSW 11 82,908,532 (GRCm39) missense probably benign
R9678:Slfn8 UTSW 11 82,907,723 (GRCm39) missense probably damaging 1.00
R9708:Slfn8 UTSW 11 82,894,267 (GRCm39) missense probably benign 0.00
R9764:Slfn8 UTSW 11 82,907,838 (GRCm39) missense probably damaging 1.00
X0021:Slfn8 UTSW 11 82,907,754 (GRCm39) missense possibly damaging 0.69
Z1177:Slfn8 UTSW 11 82,894,359 (GRCm39) missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- AAAGCCAACTTCAGTGGGTG -3'
(R):5'- CATTTGCAAACACCCAGGGAG -3'

Sequencing Primer
(F):5'- CCAACTTCAGTGGGTGTAATGAACTC -3'
(R):5'- AACACCCAGGGAGGCTATCTTTTC -3'
Posted On 2021-04-30