Incidental Mutation 'R8804:Slc17a4'
ID671941
Institutional Source Beutler Lab
Gene Symbol Slc17a4
Ensembl Gene ENSMUSG00000021336
Gene Namesolute carrier family 17 (sodium phosphate), member 4
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.053) question?
Stock #R8804 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location23895890-23915009 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 23903262 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 264 (T264K)
Ref Sequence ENSEMBL: ENSMUSP00000106037 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021769] [ENSMUST00000110407] [ENSMUST00000225797]
Predicted Effect probably benign
Transcript: ENSMUST00000021769
AA Change: T264K

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000021769
Gene: ENSMUSG00000021336
AA Change: T264K

DomainStartEndE-ValueType
Pfam:MFS_1 40 373 1.4e-48 PFAM
Pfam:MFS_1 361 492 2.4e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110407
AA Change: T264K

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000106037
Gene: ENSMUSG00000021336
AA Change: T264K

DomainStartEndE-ValueType
Pfam:MFS_1 40 371 1.7e-47 PFAM
Pfam:MFS_1 359 490 3.9e-10 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000225797
AA Change: H235N
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Phosphate homeostasis is maintained by regulating intake, intestinal absorption, bone deposition and resorption, and renal excretion of phosphate. The central molecule in the control of phosphate excretion from the kidney is the sodium/phosphate cotransporter NPT1 (SLC17A1; MIM 182308), which is located in the renal proximal tubule. NPT1 uses the transmembrane electrochemical potential gradient of sodium to transport phosphate across the cell membrane. SLC17A4 is a similar sodium/phosphate cotransporter in the intestinal mucosa that plays an important role in the absorption of phosphate from the intestine (summary by Shibui et al., 1999 [PubMed 10319585]).[supplied by OMIM, Feb 2011]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700064H15Rik T C 3: 19,628,656 probably benign Het
Adamts1 A G 16: 85,802,412 F100S probably damaging Het
Adamts5 A G 16: 85,869,912 probably benign Het
Adgrb2 T A 4: 130,005,419 W309R probably damaging Het
Adgrl2 A T 3: 148,847,016 V617E probably damaging Het
Akt1 T C 12: 112,658,607 E169G probably damaging Het
Arhgap40 A G 2: 158,547,706 T600A probably benign Het
B4galt3 C T 1: 171,276,374 H395Y probably benign Het
BC024139 T G 15: 76,124,084 T376P possibly damaging Het
Bin3 A G 14: 70,123,847 R22G probably damaging Het
Cadps2 A T 6: 23,496,806 I480N probably damaging Het
Camsap3 A G 8: 3,602,624 T401A probably benign Het
Cdhr5 T C 7: 141,269,407 T747A probably benign Het
Chn2 A G 6: 54,273,076 I193V probably benign Het
Clca3b T C 3: 144,839,137 N363S probably benign Het
Clec7a T C 6: 129,465,555 T125A probably benign Het
Cys1 A T 12: 24,668,611 L81Q unknown Het
Dcbld2 G A 16: 58,461,049 probably benign Het
Ddx60 T A 8: 61,958,606 D497E probably benign Het
Dnah2 T C 11: 69,465,685 I2117V probably benign Het
Dnah6 G A 6: 73,065,773 S3274F probably benign Het
Dock9 A T 14: 121,605,183 I1225N probably damaging Het
Egfr A G 11: 16,869,339 T290A probably benign Het
Elmod2 T A 8: 83,319,521 K142N probably benign Het
Ephx2 T C 14: 66,087,020 T441A probably benign Het
Fam234a A G 17: 26,216,557 probably benign Het
Fer1l4 C A 2: 156,051,994 E102D probably benign Het
Fermt3 A G 19: 7,014,326 probably benign Het
Fgd5 C T 6: 91,987,526 R247C probably benign Het
Gm14443 G A 2: 175,169,859 H265Y probably damaging Het
Gm8251 T C 1: 44,056,649 N1763S probably benign Het
Gykl1 A G 18: 52,694,536 D272G probably benign Het
Hip1r T C 5: 124,001,512 S952P possibly damaging Het
Hmcn2 A G 2: 31,425,381 N3714S probably benign Het
Hrasls T A 16: 29,220,453 V95E probably benign Het
Ighv1-36 G T 12: 114,879,961 T93K probably benign Het
Igsf10 T G 3: 59,336,455 T153P probably damaging Het
Kif13b T C 14: 64,750,342 C773R probably damaging Het
Lipf T A 19: 33,964,798 Y43N probably damaging Het
Mlh1 T C 9: 111,264,904 D90G probably damaging Het
Msh5 A T 17: 35,032,854 I410K probably benign Het
Mylk3 T C 8: 85,359,245 D220G probably benign Het
Ncdn G A 4: 126,750,105 A308V probably benign Het
Nup153 A G 13: 46,687,159 V991A probably benign Het
Nup188 T A 2: 30,330,879 H960Q probably benign Het
Parp4 G T 14: 56,616,443 E839* probably null Het
Pfas T C 11: 68,991,082 N30D Het
Pitpnc1 T A 11: 107,212,605 N223Y probably damaging Het
Plod1 C T 4: 147,913,321 V644I probably damaging Het
Pou2f1 T C 1: 165,880,470 T548A unknown Het
Psg20 A T 7: 18,682,659 N177K possibly damaging Het
Psmb8 T A 17: 34,200,251 I173N probably damaging Het
Rimkla G A 4: 119,468,076 Q379* probably null Het
Rnasel G T 1: 153,753,915 G59V probably damaging Het
Rptn A T 3: 93,395,843 D161V probably damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,926 probably benign Het
Scrt1 C A 15: 76,519,211 C193F unknown Het
Sdk2 G T 11: 113,873,152 Y269* probably null Het
Sfxn2 G C 19: 46,585,804 probably benign Het
Slfn8 T A 11: 83,016,813 Q301H possibly damaging Het
Sntb1 G A 15: 55,792,127 S231F probably benign Het
Spag17 T A 3: 99,967,190 S137T probably benign Het
Srd5a2 A T 17: 74,047,634 V65E possibly damaging Het
Stk11ip A G 1: 75,535,256 H967R probably benign Het
Sun1 A G 5: 139,231,165 T320A probably benign Het
Svep1 A G 4: 58,206,043 S112P possibly damaging Het
Tacc2 T C 7: 130,692,963 L15P probably benign Het
Tas2r140 T A 6: 133,055,363 N144I probably damaging Het
Thpo T A 16: 20,725,957 R174S probably damaging Het
Tnik A T 3: 28,594,053 Q418L unknown Het
Tnr A T 1: 159,858,312 Q371L probably benign Het
Tulp2 G A 7: 45,520,974 R439Q probably damaging Het
Uchl4 G T 9: 64,235,324 W29L probably damaging Het
Vrk3 T A 7: 44,757,846 C80* probably null Het
Washc4 T C 10: 83,572,151 L540P probably damaging Het
Wscd1 T C 11: 71,784,335 F356S probably damaging Het
Wwc1 A T 11: 35,883,317 M372K probably benign Het
Zfhx2 A G 14: 55,074,734 F168L probably benign Het
Zfp28 A G 7: 6,390,400 D175G probably damaging Het
Other mutations in Slc17a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01724:Slc17a4 APN 13 23905533 missense probably benign 0.06
IGL02976:Slc17a4 APN 13 23905424 missense probably damaging 0.99
PIT4581001:Slc17a4 UTSW 13 23902018 missense probably damaging 0.99
PIT4696001:Slc17a4 UTSW 13 23900514 missense probably benign 0.02
R1490:Slc17a4 UTSW 13 23904753 missense probably benign 0.29
R1726:Slc17a4 UTSW 13 23905591 nonsense probably null
R1866:Slc17a4 UTSW 13 23900545 missense possibly damaging 0.67
R3820:Slc17a4 UTSW 13 23901769 missense probably benign
R3821:Slc17a4 UTSW 13 23901769 missense probably benign
R3837:Slc17a4 UTSW 13 23901769 missense probably benign
R3838:Slc17a4 UTSW 13 23901769 missense probably benign
R3839:Slc17a4 UTSW 13 23901769 missense probably benign
R5347:Slc17a4 UTSW 13 23908817 missense possibly damaging 0.63
R5489:Slc17a4 UTSW 13 23898842 splice site probably null
R6607:Slc17a4 UTSW 13 23905414 splice site probably null
R7614:Slc17a4 UTSW 13 23906597 missense probably benign 0.02
R7730:Slc17a4 UTSW 13 23900520 nonsense probably null
R7744:Slc17a4 UTSW 13 23901784 missense probably benign 0.08
R8532:Slc17a4 UTSW 13 23904735 missense probably damaging 1.00
R8802:Slc17a4 UTSW 13 23905291 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGGGAGAGATTTCACCATGG -3'
(R):5'- TTATGACAGGGCCATTCAAGGG -3'

Sequencing Primer
(F):5'- GGAGAGATTTCACCATGGCTTTAATG -3'
(R):5'- GAGCAAGATATCAGCACTGGTCATTC -3'
Posted On2021-04-30