Incidental Mutation 'R8804:Parp4'
ID 671944
Institutional Source Beutler Lab
Gene Symbol Parp4
Ensembl Gene ENSMUSG00000054509
Gene Name poly (ADP-ribose) polymerase family, member 4
Synonyms p193, Adprtl1, E230037B21Rik, PH5P, VAULT3, VPARP, C030027K23Rik
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.180) question?
Stock # R8804 (G1)
Quality Score 225.009
Status Validated
Chromosome 14
Chromosomal Location 56575619-56659794 bp(+) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) G to T at 56616443 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 839 (E839*)
Ref Sequence ENSEMBL: ENSMUSP00000124258 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000161553]
AlphaFold E9PYK3
Predicted Effect probably null
Transcript: ENSMUST00000161553
AA Change: E839*
SMART Domains Protein: ENSMUSP00000124258
Gene: ENSMUSG00000054509
AA Change: E839*

DomainStartEndE-ValueType
BRCT 3 84 4.32e-9 SMART
low complexity region 97 104 N/A INTRINSIC
SCOP:d1a26_1 252 352 2e-19 SMART
Pfam:PARP 371 559 1.8e-50 PFAM
VIT 600 728 1.5e-57 SMART
VWA 867 1030 6.08e-13 SMART
Blast:14_3_3 1149 1205 5e-10 BLAST
low complexity region 1255 1264 N/A INTRINSIC
low complexity region 1348 1362 N/A INTRINSIC
low complexity region 1371 1394 N/A INTRINSIC
internal_repeat_1 1395 1416 4.48e-6 PROSPERO
Pfam:Drf_FH1 1443 1542 3.3e-15 PFAM
low complexity region 1553 1587 N/A INTRINSIC
internal_repeat_2 1588 1608 2.45e-5 PROSPERO
low complexity region 1695 1708 N/A INTRINSIC
low complexity region 1739 1750 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 98% (79/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes poly(ADP-ribosyl)transferase-like 1 protein, which is capable of catalyzing a poly(ADP-ribosyl)ation reaction. This protein has a catalytic domain which is homologous to that of poly (ADP-ribosyl) transferase, but lacks an N-terminal DNA binding domain which activates the C-terminal catalytic domain of poly (ADP-ribosyl) transferase. Since this protein is not capable of binding DNA directly, its transferase activity may be activated by other factors such as protein-protein interaction mediated by the extensive carboxyl terminus. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants are helathy and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700064H15Rik T C 3: 19,628,656 probably benign Het
Adamts1 A G 16: 85,802,412 F100S probably damaging Het
Adamts5 A G 16: 85,869,912 probably benign Het
Adgrb2 T A 4: 130,005,419 W309R probably damaging Het
Adgrl2 A T 3: 148,847,016 V617E probably damaging Het
Akt1 T C 12: 112,658,607 E169G probably damaging Het
Arhgap40 A G 2: 158,547,706 T600A probably benign Het
B4galt3 C T 1: 171,276,374 H395Y probably benign Het
BC024139 T G 15: 76,124,084 T376P possibly damaging Het
Bin3 A G 14: 70,123,847 R22G probably damaging Het
Cadps2 A T 6: 23,496,806 I480N probably damaging Het
Camsap3 A G 8: 3,602,624 T401A probably benign Het
Cdhr5 T C 7: 141,269,407 T747A probably benign Het
Chn2 A G 6: 54,273,076 I193V probably benign Het
Clca3b T C 3: 144,839,137 N363S probably benign Het
Clec7a T C 6: 129,465,555 T125A probably benign Het
Cys1 A T 12: 24,668,611 L81Q unknown Het
Dcbld2 G A 16: 58,461,049 probably benign Het
Ddx60 T A 8: 61,958,606 D497E probably benign Het
Dnah2 T C 11: 69,465,685 I2117V probably benign Het
Dnah6 G A 6: 73,065,773 S3274F probably benign Het
Dock9 A T 14: 121,605,183 I1225N probably damaging Het
Egfr A G 11: 16,869,339 T290A probably benign Het
Elmod2 T A 8: 83,319,521 K142N probably benign Het
Ephx2 T C 14: 66,087,020 T441A probably benign Het
Fam234a A G 17: 26,216,557 probably benign Het
Fer1l4 C A 2: 156,051,994 E102D probably benign Het
Fermt3 A G 19: 7,014,326 probably benign Het
Fgd5 C T 6: 91,987,526 R247C probably benign Het
Gm14443 G A 2: 175,169,859 H265Y probably damaging Het
Gm8251 T C 1: 44,056,649 N1763S probably benign Het
Gykl1 A G 18: 52,694,536 D272G probably benign Het
Hip1r T C 5: 124,001,512 S952P possibly damaging Het
Hmcn2 A G 2: 31,425,381 N3714S probably benign Het
Hrasls T A 16: 29,220,453 V95E probably benign Het
Ighv1-36 G T 12: 114,879,961 T93K probably benign Het
Igsf10 T G 3: 59,336,455 T153P probably damaging Het
Kif13b T C 14: 64,750,342 C773R probably damaging Het
Lipf T A 19: 33,964,798 Y43N probably damaging Het
Mlh1 T C 9: 111,264,904 D90G probably damaging Het
Msh5 A T 17: 35,032,854 I410K probably benign Het
Mylk3 T C 8: 85,359,245 D220G probably benign Het
Ncdn G A 4: 126,750,105 A308V probably benign Het
Nfu1 T A 6: 87,016,432 probably benign Het
Nup153 A G 13: 46,687,159 V991A probably benign Het
Nup188 T A 2: 30,330,879 H960Q probably benign Het
Pfas T C 11: 68,991,082 N30D Het
Pitpnc1 T A 11: 107,212,605 N223Y probably damaging Het
Plod1 C T 4: 147,913,321 V644I probably damaging Het
Pou2f1 T C 1: 165,880,470 T548A unknown Het
Psg20 A T 7: 18,682,659 N177K possibly damaging Het
Psmb8 T A 17: 34,200,251 I173N probably damaging Het
Rimkla G A 4: 119,468,076 Q379* probably null Het
Rnasel G T 1: 153,753,915 G59V probably damaging Het
Rptn A T 3: 93,395,843 D161V probably damaging Het
Scrt1 C A 15: 76,519,211 C193F unknown Het
Sdk2 G T 11: 113,873,152 Y269* probably null Het
Sfxn2 G C 19: 46,585,804 probably benign Het
Slc17a4 G T 13: 23,903,262 T264K probably benign Het
Slfn8 T A 11: 83,016,813 Q301H possibly damaging Het
Sntb1 G A 15: 55,792,127 S231F probably benign Het
Spag17 T A 3: 99,967,190 S137T probably benign Het
Srd5a2 A T 17: 74,047,634 V65E possibly damaging Het
Stk11ip A G 1: 75,535,256 H967R probably benign Het
Sun1 A G 5: 139,231,165 T320A probably benign Het
Svep1 A G 4: 58,206,043 S112P possibly damaging Het
Tacc2 T C 7: 130,692,963 L15P probably benign Het
Tas2r140 T A 6: 133,055,363 N144I probably damaging Het
Thpo T A 16: 20,725,957 R174S probably damaging Het
Tnik A T 3: 28,594,053 Q418L unknown Het
Tnr A T 1: 159,858,312 Q371L probably benign Het
Tulp2 G A 7: 45,520,974 R439Q probably damaging Het
Uchl4 G T 9: 64,235,324 W29L probably damaging Het
Vrk3 T A 7: 44,757,846 C80* probably null Het
Washc4 T C 10: 83,572,151 L540P probably damaging Het
Wscd1 T C 11: 71,784,335 F356S probably damaging Het
Wwc1 A T 11: 35,883,317 M372K probably benign Het
Zfhx2 A G 14: 55,074,734 F168L probably benign Het
Zfp28 A G 7: 6,390,400 D175G probably damaging Het
Other mutations in Parp4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00479:Parp4 APN 14 56616460 missense possibly damaging 0.82
IGL00571:Parp4 APN 14 56647353 missense unknown
IGL00737:Parp4 APN 14 56584163 missense probably damaging 0.99
IGL00793:Parp4 APN 14 56602877 missense possibly damaging 0.73
IGL01108:Parp4 APN 14 56607440 missense probably benign 0.01
IGL01131:Parp4 APN 14 56585760 splice site probably benign
IGL01485:Parp4 APN 14 56622204 missense possibly damaging 0.54
IGL01704:Parp4 APN 14 56602326 missense probably damaging 0.99
IGL01993:Parp4 APN 14 56610788 missense possibly damaging 0.82
IGL02125:Parp4 APN 14 56590502 missense probably benign 0.33
IGL02851:Parp4 APN 14 56648869 missense unknown
IGL02863:Parp4 APN 14 56648786 missense unknown
IGL03065:Parp4 APN 14 56637869 missense probably benign 0.09
IGL03117:Parp4 APN 14 56602856 missense probably benign 0.17
IGL03271:Parp4 APN 14 56585625 missense probably benign 0.10
IGL03309:Parp4 APN 14 56587808 missense probably benign 0.11
IGL03408:Parp4 APN 14 56602408 missense probably damaging 0.99
poisonous UTSW 14 56635748 missense possibly damaging 0.65
R0515_Parp4_195 UTSW 14 56613667 missense probably damaging 1.00
toxic UTSW 14 56629158 missense probably benign 0.28
venomous UTSW 14 56589898 missense possibly damaging 0.92
virulent UTSW 14 56587778 missense probably damaging 0.97
R0278:Parp4 UTSW 14 56607523 missense probably damaging 0.99
R0320:Parp4 UTSW 14 56588496 critical splice donor site probably null
R0445:Parp4 UTSW 14 56602748 splice site probably null
R0452:Parp4 UTSW 14 56648843 missense unknown
R0511:Parp4 UTSW 14 56635715 splice site probably benign
R0515:Parp4 UTSW 14 56613667 missense probably damaging 1.00
R0608:Parp4 UTSW 14 56602404 missense probably damaging 1.00
R0800:Parp4 UTSW 14 56589951 missense probably benign 0.00
R0959:Parp4 UTSW 14 56648119 missense unknown
R1207:Parp4 UTSW 14 56647882 missense unknown
R1207:Parp4 UTSW 14 56647882 missense unknown
R1342:Parp4 UTSW 14 56590397 missense probably damaging 1.00
R1520:Parp4 UTSW 14 56598406 missense probably damaging 1.00
R1565:Parp4 UTSW 14 56589872 splice site probably benign
R1574:Parp4 UTSW 14 56602295 missense probably damaging 0.98
R1574:Parp4 UTSW 14 56602295 missense probably damaging 0.98
R1649:Parp4 UTSW 14 56590428 missense possibly damaging 0.95
R1666:Parp4 UTSW 14 56624163 missense possibly damaging 0.91
R1781:Parp4 UTSW 14 56627381 splice site probably null
R1799:Parp4 UTSW 14 56648132 missense unknown
R1823:Parp4 UTSW 14 56589872 splice site probably benign
R1859:Parp4 UTSW 14 56648915 missense unknown
R1919:Parp4 UTSW 14 56624017 missense probably damaging 1.00
R2000:Parp4 UTSW 14 56613724 missense probably damaging 0.98
R2032:Parp4 UTSW 14 56629096 missense possibly damaging 0.71
R2034:Parp4 UTSW 14 56634263 missense probably damaging 1.00
R2177:Parp4 UTSW 14 56659289 missense unknown
R2291:Parp4 UTSW 14 56613817 missense probably damaging 1.00
R2865:Parp4 UTSW 14 56613724 missense probably damaging 0.98
R3012:Parp4 UTSW 14 56595416 critical splice donor site probably null
R3841:Parp4 UTSW 14 56587778 missense probably damaging 0.97
R3913:Parp4 UTSW 14 56620518 missense probably damaging 1.00
R4064:Parp4 UTSW 14 56624140 missense probably benign 0.06
R4201:Parp4 UTSW 14 56592391 missense possibly damaging 0.95
R4288:Parp4 UTSW 14 56607494 missense probably damaging 1.00
R4360:Parp4 UTSW 14 56629204 missense possibly damaging 0.89
R4506:Parp4 UTSW 14 56652304 missense unknown
R4577:Parp4 UTSW 14 56590410 missense probably benign 0.33
R4633:Parp4 UTSW 14 56647591 missense unknown
R4762:Parp4 UTSW 14 56610810 missense probably damaging 1.00
R4836:Parp4 UTSW 14 56585738 missense probably benign 0.00
R4974:Parp4 UTSW 14 56589898 missense possibly damaging 0.92
R5049:Parp4 UTSW 14 56635731 missense possibly damaging 0.81
R5479:Parp4 UTSW 14 56624095 missense probably benign 0.01
R5683:Parp4 UTSW 14 56647429 nonsense probably null
R5884:Parp4 UTSW 14 56614750 missense probably damaging 1.00
R5965:Parp4 UTSW 14 56624032 missense probably benign 0.11
R6001:Parp4 UTSW 14 56641283 missense probably benign 0.01
R6027:Parp4 UTSW 14 56629158 missense probably benign 0.28
R6230:Parp4 UTSW 14 56607533 missense probably damaging 1.00
R6242:Parp4 UTSW 14 56595399 nonsense probably null
R6355:Parp4 UTSW 14 56602300 missense possibly damaging 0.61
R6414:Parp4 UTSW 14 56627381 splice site probably null
R6418:Parp4 UTSW 14 56620651 critical splice donor site probably null
R6477:Parp4 UTSW 14 56647237 missense probably benign 0.00
R6542:Parp4 UTSW 14 56647882 missense unknown
R6759:Parp4 UTSW 14 56620490 missense probably benign 0.10
R6995:Parp4 UTSW 14 56613739 missense probably damaging 0.97
R7002:Parp4 UTSW 14 56602404 missense probably damaging 1.00
R7026:Parp4 UTSW 14 56620592 missense probably benign 0.01
R7062:Parp4 UTSW 14 56614759 missense possibly damaging 0.48
R7101:Parp4 UTSW 14 56589973 missense probably benign 0.02
R7124:Parp4 UTSW 14 56602799 missense probably benign 0.11
R7162:Parp4 UTSW 14 56648876 missense unknown
R7293:Parp4 UTSW 14 56647846 small deletion probably benign
R7297:Parp4 UTSW 14 56647681 missense not run
R7337:Parp4 UTSW 14 56602395 missense probably damaging 1.00
R7539:Parp4 UTSW 14 56635755 missense probably damaging 1.00
R7575:Parp4 UTSW 14 56637918 missense probably benign 0.28
R7808:Parp4 UTSW 14 56635748 missense possibly damaging 0.65
R7854:Parp4 UTSW 14 56659348 missense unknown
R7960:Parp4 UTSW 14 56595251 splice site probably null
R8152:Parp4 UTSW 14 56647246 missense probably benign 0.00
R8344:Parp4 UTSW 14 56648729 missense unknown
R8416:Parp4 UTSW 14 56587814 critical splice donor site probably null
R8726:Parp4 UTSW 14 56629099 missense probably benign 0.04
R8752:Parp4 UTSW 14 56648616 missense unknown
R9046:Parp4 UTSW 14 56627470 missense probably damaging 0.98
R9176:Parp4 UTSW 14 56635817 missense possibly damaging 0.54
R9303:Parp4 UTSW 14 56595333 frame shift probably null
R9303:Parp4 UTSW 14 56614767 critical splice donor site probably null
R9305:Parp4 UTSW 14 56595333 frame shift probably null
R9305:Parp4 UTSW 14 56614767 critical splice donor site probably null
R9360:Parp4 UTSW 14 56641318 critical splice donor site probably null
R9430:Parp4 UTSW 14 56629216 missense probably damaging 1.00
R9491:Parp4 UTSW 14 56595371 missense probably damaging 0.99
R9729:Parp4 UTSW 14 56648431 missense unknown
RF020:Parp4 UTSW 14 56647349 missense unknown
Z1177:Parp4 UTSW 14 56592367 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGACAGGATGCTGTTATTCCC -3'
(R):5'- TCTGGCAATAACTATACCCAGC -3'

Sequencing Primer
(F):5'- AGGATGCTGTTATTCCCTTGTTTAC -3'
(R):5'- ATACCCAGCTATTTCATGTACGTGTG -3'
Posted On 2021-04-30