Incidental Mutation 'R8804:Parp4'
ID 671944
Institutional Source Beutler Lab
Gene Symbol Parp4
Ensembl Gene ENSMUSG00000054509
Gene Name poly (ADP-ribose) polymerase family, member 4
Synonyms VPARP, Adprtl1, C030027K23Rik, VAULT3, p193, PH5P, E230037B21Rik
MMRRC Submission 068641-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.146) question?
Stock # R8804 (G1)
Quality Score 225.009
Status Validated
Chromosome 14
Chromosomal Location 56813076-56897251 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) G to T at 56853900 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 839 (E839*)
Ref Sequence ENSEMBL: ENSMUSP00000124258 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000161553]
AlphaFold E9PYK3
Predicted Effect probably null
Transcript: ENSMUST00000161553
AA Change: E839*
SMART Domains Protein: ENSMUSP00000124258
Gene: ENSMUSG00000054509
AA Change: E839*

DomainStartEndE-ValueType
BRCT 3 84 4.32e-9 SMART
low complexity region 97 104 N/A INTRINSIC
SCOP:d1a26_1 252 352 2e-19 SMART
Pfam:PARP 371 559 1.8e-50 PFAM
VIT 600 728 1.5e-57 SMART
VWA 867 1030 6.08e-13 SMART
Blast:14_3_3 1149 1205 5e-10 BLAST
low complexity region 1255 1264 N/A INTRINSIC
low complexity region 1348 1362 N/A INTRINSIC
low complexity region 1371 1394 N/A INTRINSIC
internal_repeat_1 1395 1416 4.48e-6 PROSPERO
Pfam:Drf_FH1 1443 1542 3.3e-15 PFAM
low complexity region 1553 1587 N/A INTRINSIC
internal_repeat_2 1588 1608 2.45e-5 PROSPERO
low complexity region 1695 1708 N/A INTRINSIC
low complexity region 1739 1750 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 98% (79/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes poly(ADP-ribosyl)transferase-like 1 protein, which is capable of catalyzing a poly(ADP-ribosyl)ation reaction. This protein has a catalytic domain which is homologous to that of poly (ADP-ribosyl) transferase, but lacks an N-terminal DNA binding domain which activates the C-terminal catalytic domain of poly (ADP-ribosyl) transferase. Since this protein is not capable of binding DNA directly, its transferase activity may be activated by other factors such as protein-protein interaction mediated by the extensive carboxyl terminus. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants are helathy and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700064H15Rik T C 3: 19,682,820 (GRCm39) probably benign Het
Adamts1 A G 16: 85,599,300 (GRCm39) F100S probably damaging Het
Adamts5 A G 16: 85,666,800 (GRCm39) probably benign Het
Adgrb2 T A 4: 129,899,212 (GRCm39) W309R probably damaging Het
Adgrl2 A T 3: 148,552,652 (GRCm39) V617E probably damaging Het
Akt1 T C 12: 112,625,041 (GRCm39) E169G probably damaging Het
Arhgap40 A G 2: 158,389,626 (GRCm39) T600A probably benign Het
B4galt3 C T 1: 171,103,947 (GRCm39) H395Y probably benign Het
BC024139 T G 15: 76,008,284 (GRCm39) T376P possibly damaging Het
Bin3 A G 14: 70,361,296 (GRCm39) R22G probably damaging Het
Cadps2 A T 6: 23,496,805 (GRCm39) I480N probably damaging Het
Camsap3 A G 8: 3,652,624 (GRCm39) T401A probably benign Het
Ccdc168 T C 1: 44,095,809 (GRCm39) N1763S probably benign Het
Cdhr5 T C 7: 140,849,320 (GRCm39) T747A probably benign Het
Chn2 A G 6: 54,250,061 (GRCm39) I193V probably benign Het
Clca3b T C 3: 144,544,898 (GRCm39) N363S probably benign Het
Clec7a T C 6: 129,442,518 (GRCm39) T125A probably benign Het
Cys1 A T 12: 24,718,610 (GRCm39) L81Q unknown Het
Dcbld2 G A 16: 58,281,412 (GRCm39) probably benign Het
Ddx60 T A 8: 62,411,640 (GRCm39) D497E probably benign Het
Dnah2 T C 11: 69,356,511 (GRCm39) I2117V probably benign Het
Dnah6 G A 6: 73,042,756 (GRCm39) S3274F probably benign Het
Dock9 A T 14: 121,842,595 (GRCm39) I1225N probably damaging Het
Egfr A G 11: 16,819,339 (GRCm39) T290A probably benign Het
Elmod2 T A 8: 84,046,150 (GRCm39) K142N probably benign Het
Ephx2 T C 14: 66,324,469 (GRCm39) T441A probably benign Het
Fam234a A G 17: 26,435,531 (GRCm39) probably benign Het
Fer1l4 C A 2: 155,893,914 (GRCm39) E102D probably benign Het
Fermt3 A G 19: 6,991,694 (GRCm39) probably benign Het
Fgd5 C T 6: 91,964,507 (GRCm39) R247C probably benign Het
Gm14443 G A 2: 175,011,652 (GRCm39) H265Y probably damaging Het
Gykl1 A G 18: 52,827,608 (GRCm39) D272G probably benign Het
Hip1r T C 5: 124,139,575 (GRCm39) S952P possibly damaging Het
Hmcn2 A G 2: 31,315,393 (GRCm39) N3714S probably benign Het
Ighv1-36 G T 12: 114,843,581 (GRCm39) T93K probably benign Het
Igsf10 T G 3: 59,243,876 (GRCm39) T153P probably damaging Het
Kif13b T C 14: 64,987,791 (GRCm39) C773R probably damaging Het
Lipf T A 19: 33,942,198 (GRCm39) Y43N probably damaging Het
Mlh1 T C 9: 111,093,972 (GRCm39) D90G probably damaging Het
Msh5 A T 17: 35,251,830 (GRCm39) I410K probably benign Het
Mylk3 T C 8: 86,085,874 (GRCm39) D220G probably benign Het
Ncdn G A 4: 126,643,898 (GRCm39) A308V probably benign Het
Nfu1 T A 6: 86,993,414 (GRCm39) probably benign Het
Nup153 A G 13: 46,840,635 (GRCm39) V991A probably benign Het
Nup188 T A 2: 30,220,891 (GRCm39) H960Q probably benign Het
Pfas T C 11: 68,881,908 (GRCm39) N30D Het
Pitpnc1 T A 11: 107,103,431 (GRCm39) N223Y probably damaging Het
Plaat1 T A 16: 29,039,205 (GRCm39) V95E probably benign Het
Plod1 C T 4: 147,997,778 (GRCm39) V644I probably damaging Het
Pou2f1 T C 1: 165,708,039 (GRCm39) T548A unknown Het
Psg20 A T 7: 18,416,584 (GRCm39) N177K possibly damaging Het
Psmb8 T A 17: 34,419,225 (GRCm39) I173N probably damaging Het
Rimkla G A 4: 119,325,273 (GRCm39) Q379* probably null Het
Rnasel G T 1: 153,629,661 (GRCm39) G59V probably damaging Het
Rptn A T 3: 93,303,150 (GRCm39) D161V probably damaging Het
Scrt1 C A 15: 76,403,411 (GRCm39) C193F unknown Het
Sdk2 G T 11: 113,763,978 (GRCm39) Y269* probably null Het
Sfxn2 G C 19: 46,574,243 (GRCm39) probably benign Het
Slc17a4 G T 13: 24,087,245 (GRCm39) T264K probably benign Het
Slfn8 T A 11: 82,907,639 (GRCm39) Q301H possibly damaging Het
Sntb1 G A 15: 55,655,523 (GRCm39) S231F probably benign Het
Spag17 T A 3: 99,874,506 (GRCm39) S137T probably benign Het
Srd5a2 A T 17: 74,354,629 (GRCm39) V65E possibly damaging Het
Stk11ip A G 1: 75,511,900 (GRCm39) H967R probably benign Het
Sun1 A G 5: 139,216,920 (GRCm39) T320A probably benign Het
Svep1 A G 4: 58,206,043 (GRCm39) S112P possibly damaging Het
Tacc2 T C 7: 130,294,693 (GRCm39) L15P probably benign Het
Tas2r140 T A 6: 133,032,326 (GRCm39) N144I probably damaging Het
Thpo T A 16: 20,544,707 (GRCm39) R174S probably damaging Het
Tnik A T 3: 28,648,202 (GRCm39) Q418L unknown Het
Tnr A T 1: 159,685,882 (GRCm39) Q371L probably benign Het
Tulp2 G A 7: 45,170,398 (GRCm39) R439Q probably damaging Het
Uchl4 G T 9: 64,142,606 (GRCm39) W29L probably damaging Het
Vrk3 T A 7: 44,407,270 (GRCm39) C80* probably null Het
Washc4 T C 10: 83,408,015 (GRCm39) L540P probably damaging Het
Wscd1 T C 11: 71,675,161 (GRCm39) F356S probably damaging Het
Wwc1 A T 11: 35,774,144 (GRCm39) M372K probably benign Het
Zfhx2 A G 14: 55,312,191 (GRCm39) F168L probably benign Het
Zfp28 A G 7: 6,393,399 (GRCm39) D175G probably damaging Het
Other mutations in Parp4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00479:Parp4 APN 14 56,853,917 (GRCm39) missense possibly damaging 0.82
IGL00571:Parp4 APN 14 56,884,810 (GRCm39) missense unknown
IGL00737:Parp4 APN 14 56,821,620 (GRCm39) missense probably damaging 0.99
IGL00793:Parp4 APN 14 56,840,334 (GRCm39) missense possibly damaging 0.73
IGL01108:Parp4 APN 14 56,844,897 (GRCm39) missense probably benign 0.01
IGL01131:Parp4 APN 14 56,823,217 (GRCm39) splice site probably benign
IGL01485:Parp4 APN 14 56,859,661 (GRCm39) missense possibly damaging 0.54
IGL01704:Parp4 APN 14 56,839,783 (GRCm39) missense probably damaging 0.99
IGL01993:Parp4 APN 14 56,848,245 (GRCm39) missense possibly damaging 0.82
IGL02125:Parp4 APN 14 56,827,959 (GRCm39) missense probably benign 0.33
IGL02851:Parp4 APN 14 56,886,326 (GRCm39) missense unknown
IGL02863:Parp4 APN 14 56,886,243 (GRCm39) missense unknown
IGL03065:Parp4 APN 14 56,875,326 (GRCm39) missense probably benign 0.09
IGL03117:Parp4 APN 14 56,840,313 (GRCm39) missense probably benign 0.17
IGL03271:Parp4 APN 14 56,823,082 (GRCm39) missense probably benign 0.10
IGL03309:Parp4 APN 14 56,825,265 (GRCm39) missense probably benign 0.11
IGL03408:Parp4 APN 14 56,839,865 (GRCm39) missense probably damaging 0.99
poisonous UTSW 14 56,873,205 (GRCm39) missense possibly damaging 0.65
R0515_Parp4_195 UTSW 14 56,851,124 (GRCm39) missense probably damaging 1.00
toxic UTSW 14 56,866,615 (GRCm39) missense probably benign 0.28
venomous UTSW 14 56,827,355 (GRCm39) missense possibly damaging 0.92
virulent UTSW 14 56,825,235 (GRCm39) missense probably damaging 0.97
R0278:Parp4 UTSW 14 56,844,980 (GRCm39) missense probably damaging 0.99
R0320:Parp4 UTSW 14 56,825,953 (GRCm39) critical splice donor site probably null
R0445:Parp4 UTSW 14 56,840,205 (GRCm39) splice site probably null
R0452:Parp4 UTSW 14 56,886,300 (GRCm39) missense unknown
R0511:Parp4 UTSW 14 56,873,172 (GRCm39) splice site probably benign
R0515:Parp4 UTSW 14 56,851,124 (GRCm39) missense probably damaging 1.00
R0608:Parp4 UTSW 14 56,839,861 (GRCm39) missense probably damaging 1.00
R0800:Parp4 UTSW 14 56,827,408 (GRCm39) missense probably benign 0.00
R0959:Parp4 UTSW 14 56,885,576 (GRCm39) missense unknown
R1207:Parp4 UTSW 14 56,885,339 (GRCm39) missense unknown
R1207:Parp4 UTSW 14 56,885,339 (GRCm39) missense unknown
R1342:Parp4 UTSW 14 56,827,854 (GRCm39) missense probably damaging 1.00
R1520:Parp4 UTSW 14 56,835,863 (GRCm39) missense probably damaging 1.00
R1565:Parp4 UTSW 14 56,827,329 (GRCm39) splice site probably benign
R1574:Parp4 UTSW 14 56,839,752 (GRCm39) missense probably damaging 0.98
R1574:Parp4 UTSW 14 56,839,752 (GRCm39) missense probably damaging 0.98
R1649:Parp4 UTSW 14 56,827,885 (GRCm39) missense possibly damaging 0.95
R1666:Parp4 UTSW 14 56,861,620 (GRCm39) missense possibly damaging 0.91
R1781:Parp4 UTSW 14 56,864,838 (GRCm39) splice site probably null
R1799:Parp4 UTSW 14 56,885,589 (GRCm39) missense unknown
R1823:Parp4 UTSW 14 56,827,329 (GRCm39) splice site probably benign
R1859:Parp4 UTSW 14 56,886,372 (GRCm39) missense unknown
R1919:Parp4 UTSW 14 56,861,474 (GRCm39) missense probably damaging 1.00
R2000:Parp4 UTSW 14 56,851,181 (GRCm39) missense probably damaging 0.98
R2032:Parp4 UTSW 14 56,866,553 (GRCm39) missense possibly damaging 0.71
R2034:Parp4 UTSW 14 56,871,720 (GRCm39) missense probably damaging 1.00
R2177:Parp4 UTSW 14 56,896,746 (GRCm39) missense unknown
R2291:Parp4 UTSW 14 56,851,274 (GRCm39) missense probably damaging 1.00
R2865:Parp4 UTSW 14 56,851,181 (GRCm39) missense probably damaging 0.98
R3012:Parp4 UTSW 14 56,832,873 (GRCm39) critical splice donor site probably null
R3841:Parp4 UTSW 14 56,825,235 (GRCm39) missense probably damaging 0.97
R3913:Parp4 UTSW 14 56,857,975 (GRCm39) missense probably damaging 1.00
R4064:Parp4 UTSW 14 56,861,597 (GRCm39) missense probably benign 0.06
R4201:Parp4 UTSW 14 56,829,848 (GRCm39) missense possibly damaging 0.95
R4288:Parp4 UTSW 14 56,844,951 (GRCm39) missense probably damaging 1.00
R4360:Parp4 UTSW 14 56,866,661 (GRCm39) missense possibly damaging 0.89
R4506:Parp4 UTSW 14 56,889,761 (GRCm39) missense unknown
R4577:Parp4 UTSW 14 56,827,867 (GRCm39) missense probably benign 0.33
R4633:Parp4 UTSW 14 56,885,048 (GRCm39) missense unknown
R4762:Parp4 UTSW 14 56,848,267 (GRCm39) missense probably damaging 1.00
R4836:Parp4 UTSW 14 56,823,195 (GRCm39) missense probably benign 0.00
R4974:Parp4 UTSW 14 56,827,355 (GRCm39) missense possibly damaging 0.92
R5049:Parp4 UTSW 14 56,873,188 (GRCm39) missense possibly damaging 0.81
R5479:Parp4 UTSW 14 56,861,552 (GRCm39) missense probably benign 0.01
R5683:Parp4 UTSW 14 56,884,886 (GRCm39) nonsense probably null
R5884:Parp4 UTSW 14 56,852,207 (GRCm39) missense probably damaging 1.00
R5965:Parp4 UTSW 14 56,861,489 (GRCm39) missense probably benign 0.11
R6001:Parp4 UTSW 14 56,878,740 (GRCm39) missense probably benign 0.01
R6027:Parp4 UTSW 14 56,866,615 (GRCm39) missense probably benign 0.28
R6230:Parp4 UTSW 14 56,844,990 (GRCm39) missense probably damaging 1.00
R6242:Parp4 UTSW 14 56,832,856 (GRCm39) nonsense probably null
R6355:Parp4 UTSW 14 56,839,757 (GRCm39) missense possibly damaging 0.61
R6414:Parp4 UTSW 14 56,864,838 (GRCm39) splice site probably null
R6418:Parp4 UTSW 14 56,858,108 (GRCm39) critical splice donor site probably null
R6477:Parp4 UTSW 14 56,884,694 (GRCm39) missense probably benign 0.00
R6542:Parp4 UTSW 14 56,885,339 (GRCm39) missense unknown
R6759:Parp4 UTSW 14 56,857,947 (GRCm39) missense probably benign 0.10
R6995:Parp4 UTSW 14 56,851,196 (GRCm39) missense probably damaging 0.97
R7002:Parp4 UTSW 14 56,839,861 (GRCm39) missense probably damaging 1.00
R7026:Parp4 UTSW 14 56,858,049 (GRCm39) missense probably benign 0.01
R7062:Parp4 UTSW 14 56,852,216 (GRCm39) missense possibly damaging 0.48
R7101:Parp4 UTSW 14 56,827,430 (GRCm39) missense probably benign 0.02
R7124:Parp4 UTSW 14 56,840,256 (GRCm39) missense probably benign 0.11
R7162:Parp4 UTSW 14 56,886,333 (GRCm39) missense unknown
R7293:Parp4 UTSW 14 56,885,303 (GRCm39) small deletion probably benign
R7297:Parp4 UTSW 14 56,885,138 (GRCm39) missense not run
R7337:Parp4 UTSW 14 56,839,852 (GRCm39) missense probably damaging 1.00
R7539:Parp4 UTSW 14 56,873,212 (GRCm39) missense probably damaging 1.00
R7575:Parp4 UTSW 14 56,875,375 (GRCm39) missense probably benign 0.28
R7808:Parp4 UTSW 14 56,873,205 (GRCm39) missense possibly damaging 0.65
R7854:Parp4 UTSW 14 56,896,805 (GRCm39) missense unknown
R7960:Parp4 UTSW 14 56,832,708 (GRCm39) splice site probably null
R8152:Parp4 UTSW 14 56,884,703 (GRCm39) missense probably benign 0.00
R8344:Parp4 UTSW 14 56,886,186 (GRCm39) missense unknown
R8416:Parp4 UTSW 14 56,825,271 (GRCm39) critical splice donor site probably null
R8726:Parp4 UTSW 14 56,866,556 (GRCm39) missense probably benign 0.04
R8752:Parp4 UTSW 14 56,886,073 (GRCm39) missense unknown
R9046:Parp4 UTSW 14 56,864,927 (GRCm39) missense probably damaging 0.98
R9176:Parp4 UTSW 14 56,873,274 (GRCm39) missense possibly damaging 0.54
R9303:Parp4 UTSW 14 56,852,224 (GRCm39) critical splice donor site probably null
R9303:Parp4 UTSW 14 56,832,790 (GRCm39) frame shift probably null
R9305:Parp4 UTSW 14 56,852,224 (GRCm39) critical splice donor site probably null
R9305:Parp4 UTSW 14 56,832,790 (GRCm39) frame shift probably null
R9360:Parp4 UTSW 14 56,878,775 (GRCm39) critical splice donor site probably null
R9430:Parp4 UTSW 14 56,866,673 (GRCm39) missense probably damaging 1.00
R9491:Parp4 UTSW 14 56,832,828 (GRCm39) missense probably damaging 0.99
R9729:Parp4 UTSW 14 56,885,888 (GRCm39) missense unknown
RF020:Parp4 UTSW 14 56,884,806 (GRCm39) missense unknown
Z1177:Parp4 UTSW 14 56,829,824 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGACAGGATGCTGTTATTCCC -3'
(R):5'- TCTGGCAATAACTATACCCAGC -3'

Sequencing Primer
(F):5'- AGGATGCTGTTATTCCCTTGTTTAC -3'
(R):5'- ATACCCAGCTATTTCATGTACGTGTG -3'
Posted On 2021-04-30