Incidental Mutation 'R8804:Adamts5'
ID 671956
Institutional Source Beutler Lab
Gene Symbol Adamts5
Ensembl Gene ENSMUSG00000022894
Gene Name ADAM metallopeptidase with thrombospondin type 1 motif 5
Synonyms ADAM-TS5, 9530092O11Rik
MMRRC Submission 068641-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.209) question?
Stock # R8804 (G1)
Quality Score 225.009
Status Validated
Chromosome 16
Chromosomal Location 85655045-85698013 bp(-) (GRCm39)
Type of Mutation critical splice donor site
DNA Base Change (assembly) A to G at 85666800 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000023611 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023611]
AlphaFold Q9R001
Predicted Effect probably benign
Transcript: ENSMUST00000023611
SMART Domains Protein: ENSMUSP00000023611
Gene: ENSMUSG00000022894

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Pep_M12B_propep 41 182 9.1e-18 PFAM
low complexity region 226 232 N/A INTRINSIC
Pfam:Reprolysin_5 265 450 2.1e-16 PFAM
Pfam:Reprolysin_4 265 472 4.8e-14 PFAM
Pfam:Reprolysin 267 476 4.6e-26 PFAM
Pfam:Reprolysin_2 286 466 3.7e-13 PFAM
Pfam:Reprolysin_3 288 421 6.9e-17 PFAM
Blast:ACR 477 555 4e-15 BLAST
low complexity region 556 566 N/A INTRINSIC
TSP1 570 622 6.04e-13 SMART
Pfam:ADAM_spacer1 732 852 1.7e-35 PFAM
TSP1 878 926 7.12e-2 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 98% (79/81)
MGI Phenotype FUNCTION: This gene encodes a member of "a disintegrin and metalloproteinase with thrombospondin motifs" (ADAMTS) family of multi-domain matrix-associated metalloendopeptidases that have diverse roles in tissue morphogenesis and pathophysiological remodeling, in inflammation and in vascular biology. The encoded preproprotein undergoes proteolytic processing to generate an active, zinc-dependent aggrecanase enzyme. Mice lacking the encoded protein are protected from surgery-induced osteoarthritis and antigen-induced arthritis. [provided by RefSeq, May 2016]
PHENOTYPE: Mice homozygous for one null allele exhibit a significant reduction in cartilage degradation after induction of osteoarthritis whereas those homozygous for another show no affect. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700064H15Rik T C 3: 19,682,820 (GRCm39) probably benign Het
Adamts1 A G 16: 85,599,300 (GRCm39) F100S probably damaging Het
Adgrb2 T A 4: 129,899,212 (GRCm39) W309R probably damaging Het
Adgrl2 A T 3: 148,552,652 (GRCm39) V617E probably damaging Het
Akt1 T C 12: 112,625,041 (GRCm39) E169G probably damaging Het
Arhgap40 A G 2: 158,389,626 (GRCm39) T600A probably benign Het
B4galt3 C T 1: 171,103,947 (GRCm39) H395Y probably benign Het
BC024139 T G 15: 76,008,284 (GRCm39) T376P possibly damaging Het
Bin3 A G 14: 70,361,296 (GRCm39) R22G probably damaging Het
Cadps2 A T 6: 23,496,805 (GRCm39) I480N probably damaging Het
Camsap3 A G 8: 3,652,624 (GRCm39) T401A probably benign Het
Ccdc168 T C 1: 44,095,809 (GRCm39) N1763S probably benign Het
Cdhr5 T C 7: 140,849,320 (GRCm39) T747A probably benign Het
Chn2 A G 6: 54,250,061 (GRCm39) I193V probably benign Het
Clca3b T C 3: 144,544,898 (GRCm39) N363S probably benign Het
Clec7a T C 6: 129,442,518 (GRCm39) T125A probably benign Het
Cys1 A T 12: 24,718,610 (GRCm39) L81Q unknown Het
Dcbld2 G A 16: 58,281,412 (GRCm39) probably benign Het
Ddx60 T A 8: 62,411,640 (GRCm39) D497E probably benign Het
Dnah2 T C 11: 69,356,511 (GRCm39) I2117V probably benign Het
Dnah6 G A 6: 73,042,756 (GRCm39) S3274F probably benign Het
Dock9 A T 14: 121,842,595 (GRCm39) I1225N probably damaging Het
Egfr A G 11: 16,819,339 (GRCm39) T290A probably benign Het
Elmod2 T A 8: 84,046,150 (GRCm39) K142N probably benign Het
Ephx2 T C 14: 66,324,469 (GRCm39) T441A probably benign Het
Fam234a A G 17: 26,435,531 (GRCm39) probably benign Het
Fer1l4 C A 2: 155,893,914 (GRCm39) E102D probably benign Het
Fermt3 A G 19: 6,991,694 (GRCm39) probably benign Het
Fgd5 C T 6: 91,964,507 (GRCm39) R247C probably benign Het
Gm14443 G A 2: 175,011,652 (GRCm39) H265Y probably damaging Het
Gykl1 A G 18: 52,827,608 (GRCm39) D272G probably benign Het
Hip1r T C 5: 124,139,575 (GRCm39) S952P possibly damaging Het
Hmcn2 A G 2: 31,315,393 (GRCm39) N3714S probably benign Het
Ighv1-36 G T 12: 114,843,581 (GRCm39) T93K probably benign Het
Igsf10 T G 3: 59,243,876 (GRCm39) T153P probably damaging Het
Kif13b T C 14: 64,987,791 (GRCm39) C773R probably damaging Het
Lipf T A 19: 33,942,198 (GRCm39) Y43N probably damaging Het
Mlh1 T C 9: 111,093,972 (GRCm39) D90G probably damaging Het
Msh5 A T 17: 35,251,830 (GRCm39) I410K probably benign Het
Mylk3 T C 8: 86,085,874 (GRCm39) D220G probably benign Het
Ncdn G A 4: 126,643,898 (GRCm39) A308V probably benign Het
Nfu1 T A 6: 86,993,414 (GRCm39) probably benign Het
Nup153 A G 13: 46,840,635 (GRCm39) V991A probably benign Het
Nup188 T A 2: 30,220,891 (GRCm39) H960Q probably benign Het
Parp4 G T 14: 56,853,900 (GRCm39) E839* probably null Het
Pfas T C 11: 68,881,908 (GRCm39) N30D Het
Pitpnc1 T A 11: 107,103,431 (GRCm39) N223Y probably damaging Het
Plaat1 T A 16: 29,039,205 (GRCm39) V95E probably benign Het
Plod1 C T 4: 147,997,778 (GRCm39) V644I probably damaging Het
Pou2f1 T C 1: 165,708,039 (GRCm39) T548A unknown Het
Psg20 A T 7: 18,416,584 (GRCm39) N177K possibly damaging Het
Psmb8 T A 17: 34,419,225 (GRCm39) I173N probably damaging Het
Rimkla G A 4: 119,325,273 (GRCm39) Q379* probably null Het
Rnasel G T 1: 153,629,661 (GRCm39) G59V probably damaging Het
Rptn A T 3: 93,303,150 (GRCm39) D161V probably damaging Het
Scrt1 C A 15: 76,403,411 (GRCm39) C193F unknown Het
Sdk2 G T 11: 113,763,978 (GRCm39) Y269* probably null Het
Sfxn2 G C 19: 46,574,243 (GRCm39) probably benign Het
Slc17a4 G T 13: 24,087,245 (GRCm39) T264K probably benign Het
Slfn8 T A 11: 82,907,639 (GRCm39) Q301H possibly damaging Het
Sntb1 G A 15: 55,655,523 (GRCm39) S231F probably benign Het
Spag17 T A 3: 99,874,506 (GRCm39) S137T probably benign Het
Srd5a2 A T 17: 74,354,629 (GRCm39) V65E possibly damaging Het
Stk11ip A G 1: 75,511,900 (GRCm39) H967R probably benign Het
Sun1 A G 5: 139,216,920 (GRCm39) T320A probably benign Het
Svep1 A G 4: 58,206,043 (GRCm39) S112P possibly damaging Het
Tacc2 T C 7: 130,294,693 (GRCm39) L15P probably benign Het
Tas2r140 T A 6: 133,032,326 (GRCm39) N144I probably damaging Het
Thpo T A 16: 20,544,707 (GRCm39) R174S probably damaging Het
Tnik A T 3: 28,648,202 (GRCm39) Q418L unknown Het
Tnr A T 1: 159,685,882 (GRCm39) Q371L probably benign Het
Tulp2 G A 7: 45,170,398 (GRCm39) R439Q probably damaging Het
Uchl4 G T 9: 64,142,606 (GRCm39) W29L probably damaging Het
Vrk3 T A 7: 44,407,270 (GRCm39) C80* probably null Het
Washc4 T C 10: 83,408,015 (GRCm39) L540P probably damaging Het
Wscd1 T C 11: 71,675,161 (GRCm39) F356S probably damaging Het
Wwc1 A T 11: 35,774,144 (GRCm39) M372K probably benign Het
Zfhx2 A G 14: 55,312,191 (GRCm39) F168L probably benign Het
Zfp28 A G 7: 6,393,399 (GRCm39) D175G probably damaging Het
Other mutations in Adamts5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01063:Adamts5 APN 16 85,696,722 (GRCm39) missense probably damaging 1.00
IGL01070:Adamts5 APN 16 85,660,021 (GRCm39) missense probably damaging 1.00
IGL01321:Adamts5 APN 16 85,696,363 (GRCm39) missense probably benign 0.03
IGL01616:Adamts5 APN 16 85,684,702 (GRCm39) splice site probably null
IGL02551:Adamts5 APN 16 85,666,926 (GRCm39) missense possibly damaging 0.71
IGL03263:Adamts5 APN 16 85,666,830 (GRCm39) missense probably damaging 0.99
IGL03295:Adamts5 APN 16 85,674,833 (GRCm39) missense probably damaging 1.00
IGL03393:Adamts5 APN 16 85,665,083 (GRCm39) missense probably damaging 0.99
IGL03403:Adamts5 APN 16 85,659,902 (GRCm39) missense probably damaging 0.97
R0414:Adamts5 UTSW 16 85,674,794 (GRCm39) missense probably damaging 1.00
R0419:Adamts5 UTSW 16 85,663,530 (GRCm39) missense probably benign 0.00
R0539:Adamts5 UTSW 16 85,665,580 (GRCm39) missense probably damaging 1.00
R0570:Adamts5 UTSW 16 85,696,135 (GRCm39) missense probably damaging 1.00
R0574:Adamts5 UTSW 16 85,696,372 (GRCm39) missense probably damaging 0.99
R0669:Adamts5 UTSW 16 85,696,614 (GRCm39) missense probably benign 0.45
R1454:Adamts5 UTSW 16 85,666,881 (GRCm39) missense possibly damaging 0.88
R1498:Adamts5 UTSW 16 85,696,990 (GRCm39) missense possibly damaging 0.63
R1729:Adamts5 UTSW 16 85,674,803 (GRCm39) nonsense probably null
R1753:Adamts5 UTSW 16 85,696,240 (GRCm39) missense probably damaging 1.00
R1784:Adamts5 UTSW 16 85,674,803 (GRCm39) nonsense probably null
R1906:Adamts5 UTSW 16 85,665,573 (GRCm39) nonsense probably null
R1946:Adamts5 UTSW 16 85,696,131 (GRCm39) missense probably damaging 1.00
R2180:Adamts5 UTSW 16 85,684,812 (GRCm39) missense probably damaging 1.00
R2223:Adamts5 UTSW 16 85,696,194 (GRCm39) missense probably damaging 1.00
R2366:Adamts5 UTSW 16 85,659,646 (GRCm39) missense probably damaging 1.00
R3889:Adamts5 UTSW 16 85,665,009 (GRCm39) missense probably damaging 1.00
R4214:Adamts5 UTSW 16 85,665,531 (GRCm39) missense probably damaging 1.00
R4909:Adamts5 UTSW 16 85,696,954 (GRCm39) nonsense probably null
R5119:Adamts5 UTSW 16 85,696,466 (GRCm39) missense probably benign 0.00
R5230:Adamts5 UTSW 16 85,666,956 (GRCm39) missense probably damaging 0.97
R5452:Adamts5 UTSW 16 85,666,800 (GRCm39) critical splice donor site probably benign
R5652:Adamts5 UTSW 16 85,696,156 (GRCm39) missense probably damaging 1.00
R5831:Adamts5 UTSW 16 85,665,006 (GRCm39) missense probably damaging 1.00
R6045:Adamts5 UTSW 16 85,696,188 (GRCm39) missense probably damaging 0.99
R6259:Adamts5 UTSW 16 85,696,641 (GRCm39) missense probably benign 0.03
R6384:Adamts5 UTSW 16 85,659,716 (GRCm39) missense probably benign 0.00
R6724:Adamts5 UTSW 16 85,665,445 (GRCm39) missense probably benign 0.06
R6829:Adamts5 UTSW 16 85,666,959 (GRCm39) missense possibly damaging 0.52
R7066:Adamts5 UTSW 16 85,659,652 (GRCm39) missense probably damaging 1.00
R7256:Adamts5 UTSW 16 85,659,923 (GRCm39) missense probably damaging 1.00
R7293:Adamts5 UTSW 16 85,696,833 (GRCm39) missense probably benign 0.10
R7298:Adamts5 UTSW 16 85,696,806 (GRCm39) missense probably benign 0.35
R7384:Adamts5 UTSW 16 85,696,714 (GRCm39) missense probably benign 0.02
R7452:Adamts5 UTSW 16 85,674,869 (GRCm39) missense probably benign 0.00
R7727:Adamts5 UTSW 16 85,696,854 (GRCm39) missense probably damaging 1.00
R7785:Adamts5 UTSW 16 85,659,892 (GRCm39) missense probably damaging 0.99
R7894:Adamts5 UTSW 16 85,674,808 (GRCm39) nonsense probably null
R8111:Adamts5 UTSW 16 85,696,203 (GRCm39) missense probably damaging 1.00
R8370:Adamts5 UTSW 16 85,696,881 (GRCm39) missense possibly damaging 0.74
R8413:Adamts5 UTSW 16 85,663,506 (GRCm39) critical splice donor site probably null
R8505:Adamts5 UTSW 16 85,696,944 (GRCm39) missense probably benign 0.42
R9209:Adamts5 UTSW 16 85,666,971 (GRCm39) missense probably damaging 1.00
R9455:Adamts5 UTSW 16 85,667,017 (GRCm39) missense probably damaging 0.99
R9616:Adamts5 UTSW 16 85,659,674 (GRCm39) missense probably benign 0.34
X0062:Adamts5 UTSW 16 85,660,045 (GRCm39) missense probably damaging 1.00
Z1177:Adamts5 UTSW 16 85,666,962 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCGTGAAATCATGGAGTTTGC -3'
(R):5'- CATTTGGGCCTGAGTACTCG -3'

Sequencing Primer
(F):5'- CATGGAGTTTGCCAAGAAATCCCTG -3'
(R):5'- TGAGTACTCGGTGTGCCC -3'
Posted On 2021-04-30