Incidental Mutation 'R8805:Cps1'
ID 671967
Institutional Source Beutler Lab
Gene Symbol Cps1
Ensembl Gene ENSMUSG00000025991
Gene Name carbamoyl-phosphate synthetase 1
Synonyms CPSase I, D1Ucla3, CPS, 4732433M03Rik
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8805 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 67123026-67231259 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 67176951 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Threonine at position 812 (A812T)
Ref Sequence ENSEMBL: ENSMUSP00000027144 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027144]
AlphaFold Q8C196
Predicted Effect probably damaging
Transcript: ENSMUST00000027144
AA Change: A812T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000027144
Gene: ENSMUSG00000025991
AA Change: A812T

DomainStartEndE-ValueType
CPSase_sm_chain 44 184 2.5e-70 SMART
Pfam:GATase 221 397 1.5e-40 PFAM
low complexity region 426 436 N/A INTRINSIC
Pfam:ATP-grasp_4 543 724 6.8e-12 PFAM
Pfam:CPSase_L_D2 546 750 1.7e-85 PFAM
Pfam:ATP-grasp 554 722 4.9e-8 PFAM
Pfam:Dala_Dala_lig_C 561 718 1.5e-7 PFAM
CPSase_L_D3 839 962 1.18e-57 SMART
Pfam:ATP-grasp_4 1085 1264 1e-19 PFAM
Pfam:CPSase_L_D2 1088 1291 7.4e-32 PFAM
Pfam:Dala_Dala_lig_C 1095 1279 1.6e-6 PFAM
Pfam:ATP-grasp 1096 1263 2.8e-12 PFAM
MGS 1373 1465 1.53e-15 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 96% (70/73)
MGI Phenotype FUNCTION: This gene encodes a protein localized to the inner mitochondrial matrix. The encoded protein plays a role in the detoxification of ammonia by catalyzing the first step in the urea cycle in which carbomyl-phosphate is synthesized from ammonia and bicarbonate. Carbamoyl-phosphate is subsequently converted to urea that is excreted by the kidneys. Deficiency of the encoded enzyme leads to an accumulation of ammonia in the blood. High levels of ammonia are toxic to the central nervous system and result in neurological disorders. [provided by RefSeq, Oct 2013]
PHENOTYPE: Homozygous mutation of this gene results in death by 36 hours after birth and hyperammonemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik G A 17: 9,007,905 W467* probably null Het
4921509C19Rik A T 2: 151,471,365 probably benign Het
Actl6b G A 5: 137,554,656 M82I probably benign Het
Bmp2 T A 2: 133,561,334 D268E probably damaging Het
C530008M17Rik T C 5: 76,858,642 V950A unknown Het
Cacng7 T A 7: 3,366,782 L221H probably damaging Het
Ccser2 A G 14: 36,879,755 V224A probably damaging Het
Cdc40 A G 10: 40,857,580 F125L probably damaging Het
Cfap46 C T 7: 139,632,063 A1669T unknown Het
Cfap58 A T 19: 47,953,096 E301V probably damaging Het
Clcn2 C A 16: 20,713,418 G96C probably damaging Het
Cotl1 T A 8: 119,810,205 probably benign Het
Crnkl1 T C 2: 145,931,430 probably null Het
Cry1 A G 10: 85,157,105 V83A probably benign Het
Cyp2a5 G T 7: 26,841,105 R381L probably damaging Het
Cyp46a1 T C 12: 108,361,203 F425L probably damaging Het
Dek A T 13: 47,099,454 N158K unknown Het
Dgcr8 T A 16: 18,258,297 Q674L probably damaging Het
Dlec1 C A 9: 119,112,582 S345R probably benign Het
Dnah7b T A 1: 46,234,145 C2478S possibly damaging Het
Dstyk T A 1: 132,434,225 L131Q probably damaging Het
Fbxw7 T A 3: 84,954,920 L186M Het
Fn1 T C 1: 71,605,080 Q1684R probably benign Het
Fsip2 C A 2: 82,983,109 H3257Q possibly damaging Het
Gm5773 T C 3: 93,773,735 V238A probably damaging Het
Gm9611 T C 14: 42,294,700 D131G Het
Gpatch8 T C 11: 102,480,192 E840G unknown Het
Grm5 G A 7: 87,803,968 R271Q probably damaging Het
Has3 A T 8: 106,874,503 Y199F probably damaging Het
Hmcn2 A G 2: 31,425,381 N3714S probably benign Het
Idh1 CA CAA 1: 65,165,188 probably null Het
Il2 T A 3: 37,123,133 T85S possibly damaging Het
Kank4 T C 4: 98,780,036 H58R possibly damaging Het
Kcnk4 T A 19: 6,928,011 I154F probably damaging Het
Krt2 T C 15: 101,815,944 K295R possibly damaging Het
Lipm A T 19: 34,112,908 D163V probably damaging Het
Lpl A G 8: 68,887,563 N70S probably damaging Het
Mgme1 A G 2: 144,272,531 probably benign Het
Mnd1 T A 3: 84,088,125 E187D probably benign Het
Morn5 A G 2: 36,079,521 D149G probably benign Het
Mrrf G A 2: 36,147,953 V79I probably damaging Het
Msh4 T A 3: 153,857,633 Q896L probably benign Het
Mtus2 A C 5: 148,078,493 M699L possibly damaging Het
Mycbp T A 4: 123,910,087 C130S unknown Het
Ntn5 A T 7: 45,684,475 Y4F probably benign Het
Olfr868 T C 9: 20,101,284 V175A probably benign Het
Osm A G 11: 4,239,839 S208G probably benign Het
Pcsk6 T A 7: 65,929,143 Y222N possibly damaging Het
Pde6a A G 18: 61,257,033 E486G probably benign Het
Pdzk1 T A 3: 96,851,594 L105Q possibly damaging Het
Prkd1 C G 12: 50,388,372 S524T probably benign Het
Prkd1 T A 12: 50,388,373 S524C probably damaging Het
Rab4b T C 7: 27,174,723 I90V Het
Rc3h1 T C 1: 160,967,652 V1083A probably benign Het
Rfx7 C T 9: 72,617,034 T502I probably benign Het
Rtn4rl2 T C 2: 84,872,214 Y332C probably damaging Het
Senp2 A G 16: 22,028,039 T265A probably benign Het
Slc38a3 T C 9: 107,655,146 M396V probably benign Het
Sord G A 2: 122,264,126 V332I probably benign Het
Sprr1b GTGGCAGGGCTCAGGAGCCTTGGGGTGGCAGGGCTCAGGAGCCTTGGGATGGCAGGGCTCAGGAGCCTTGGGGTGGCAGGGCTCAGGA GTGGCAGGGCTCAGGAGCCTTGGGGTGGCAGGGCTCAGGA 3: 92,437,346 probably benign Het
Star G A 8: 25,809,549 R53H probably benign Het
Stard4 T G 18: 33,203,696 I189L possibly damaging Het
Stk38 G T 17: 29,000,120 T7K probably benign Het
Stxbp5 T A 10: 9,838,115 K227* probably null Het
Taf4b C T 18: 14,813,428 P436L possibly damaging Het
Tgm3 T A 2: 130,047,782 V632E probably damaging Het
Tmem158 A G 9: 123,260,244 F101S probably damaging Het
Trmt10b T C 4: 45,301,281 S77P probably benign Het
Ttn A T 2: 76,889,963 L6973* probably null Het
Tubal3 T C 13: 3,933,293 F358L probably damaging Het
Vmn1r214 C T 13: 23,035,103 L256F possibly damaging Het
Vmn2r86 A G 10: 130,446,527 V740A probably benign Het
Yipf1 A T 4: 107,336,158 E80D probably benign Het
Zcchc11 T C 4: 108,549,378 V1381A possibly damaging Het
Zdhhc2 G T 8: 40,445,805 probably null Het
Zfp655 C T 5: 145,244,480 H383Y probably damaging Het
Zfp981 C T 4: 146,537,953 T445I possibly damaging Het
Other mutations in Cps1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00757:Cps1 APN 1 67152380 splice site probably benign
IGL00897:Cps1 APN 1 67215564 missense probably benign 0.08
IGL00928:Cps1 APN 1 67123234 missense probably benign
IGL01063:Cps1 APN 1 67195166 missense possibly damaging 0.91
IGL01081:Cps1 APN 1 67206824 missense probably damaging 1.00
IGL01361:Cps1 APN 1 67195145 missense probably benign 0.03
IGL01396:Cps1 APN 1 67157786 missense probably damaging 1.00
IGL01516:Cps1 APN 1 67230284 missense probably damaging 0.99
IGL01695:Cps1 APN 1 67197035 missense probably benign
IGL02022:Cps1 APN 1 67172872 splice site probably benign
IGL02032:Cps1 APN 1 67230315 missense probably benign 0.03
IGL02049:Cps1 APN 1 67143954 missense possibly damaging 0.68
IGL02197:Cps1 APN 1 67157764 missense probably benign
IGL02217:Cps1 APN 1 67174382 missense probably benign 0.06
IGL02555:Cps1 APN 1 67214021 missense probably benign 0.06
IGL02570:Cps1 APN 1 67148703 splice site probably benign
IGL02633:Cps1 APN 1 67123237 missense probably benign
IGL02711:Cps1 APN 1 67212517 splice site probably benign
IGL02737:Cps1 APN 1 67148774 missense probably benign 0.35
IGL03030:Cps1 APN 1 67142921 missense probably damaging 1.00
IGL03255:Cps1 APN 1 67145801 nonsense probably null
Madman UTSW 1 67160871 missense probably damaging 0.96
maniac UTSW 1 67157878 critical splice donor site probably null
R0109:Cps1 UTSW 1 67229418 missense possibly damaging 0.82
R0109:Cps1 UTSW 1 67229418 missense possibly damaging 0.82
R0140:Cps1 UTSW 1 67180116 missense probably benign
R0318:Cps1 UTSW 1 67177014 missense probably damaging 0.99
R0486:Cps1 UTSW 1 67165392 missense probably damaging 1.00
R0488:Cps1 UTSW 1 67148808 splice site probably benign
R0492:Cps1 UTSW 1 67157836 missense probably damaging 1.00
R0521:Cps1 UTSW 1 67215564 missense probably benign 0.02
R0534:Cps1 UTSW 1 67143900 missense probably benign 0.06
R0565:Cps1 UTSW 1 67166449 missense possibly damaging 0.57
R0609:Cps1 UTSW 1 67172802 missense probably damaging 1.00
R0612:Cps1 UTSW 1 67139770 missense probably benign 0.01
R1185:Cps1 UTSW 1 67195199 missense probably benign 0.00
R1185:Cps1 UTSW 1 67195199 missense probably benign 0.00
R1185:Cps1 UTSW 1 67195199 missense probably benign 0.00
R1220:Cps1 UTSW 1 67204703 critical splice donor site probably null
R1321:Cps1 UTSW 1 67143019 splice site probably benign
R1343:Cps1 UTSW 1 67209609 missense probably damaging 1.00
R1373:Cps1 UTSW 1 67229424 missense possibly damaging 0.89
R1374:Cps1 UTSW 1 67230281 missense probably damaging 0.97
R1481:Cps1 UTSW 1 67143882 missense probably damaging 0.99
R1711:Cps1 UTSW 1 67168374 splice site probably null
R1712:Cps1 UTSW 1 67230281 missense probably damaging 0.97
R1774:Cps1 UTSW 1 67170882 missense possibly damaging 0.94
R1799:Cps1 UTSW 1 67209642 missense probably damaging 1.00
R1954:Cps1 UTSW 1 67195196 missense possibly damaging 0.71
R2074:Cps1 UTSW 1 67204638 missense probably benign 0.21
R2078:Cps1 UTSW 1 67157806 missense probably damaging 1.00
R2078:Cps1 UTSW 1 67195265 missense possibly damaging 0.74
R2111:Cps1 UTSW 1 67176980 missense probably benign 0.01
R2112:Cps1 UTSW 1 67176980 missense probably benign 0.01
R2146:Cps1 UTSW 1 67152379 splice site probably benign
R2355:Cps1 UTSW 1 67156224 missense probably damaging 1.00
R2375:Cps1 UTSW 1 67217860 missense probably benign 0.00
R2860:Cps1 UTSW 1 67166375 missense probably benign 0.44
R2861:Cps1 UTSW 1 67166375 missense probably benign 0.44
R2979:Cps1 UTSW 1 67204704 critical splice donor site probably null
R3427:Cps1 UTSW 1 67174494 missense probably damaging 1.00
R3833:Cps1 UTSW 1 67139787 missense probably damaging 1.00
R3857:Cps1 UTSW 1 67168278 missense probably damaging 1.00
R3858:Cps1 UTSW 1 67168278 missense probably damaging 1.00
R3859:Cps1 UTSW 1 67168278 missense probably damaging 1.00
R3886:Cps1 UTSW 1 67165500 missense possibly damaging 0.83
R3887:Cps1 UTSW 1 67165500 missense possibly damaging 0.83
R3888:Cps1 UTSW 1 67165500 missense possibly damaging 0.83
R3889:Cps1 UTSW 1 67165500 missense possibly damaging 0.83
R4386:Cps1 UTSW 1 67170995 critical splice donor site probably null
R4497:Cps1 UTSW 1 67205199 missense probably null 1.00
R4671:Cps1 UTSW 1 67196560 missense probably damaging 1.00
R4774:Cps1 UTSW 1 67220512 missense probably damaging 0.99
R4799:Cps1 UTSW 1 67142986 missense probably damaging 0.96
R4853:Cps1 UTSW 1 67156202 missense possibly damaging 0.51
R4884:Cps1 UTSW 1 67177024 missense probably benign 0.11
R4900:Cps1 UTSW 1 67160904 missense probably damaging 1.00
R4906:Cps1 UTSW 1 67139763 missense probably benign 0.10
R5091:Cps1 UTSW 1 67229520 critical splice donor site probably null
R5102:Cps1 UTSW 1 67206793 missense probably benign 0.00
R5215:Cps1 UTSW 1 67166380 missense possibly damaging 0.62
R5290:Cps1 UTSW 1 67172709 missense probably benign 0.21
R5732:Cps1 UTSW 1 67157764 missense probably benign 0.22
R5818:Cps1 UTSW 1 67166488 missense possibly damaging 0.96
R5878:Cps1 UTSW 1 67157878 critical splice donor site probably null
R6002:Cps1 UTSW 1 67172755 missense possibly damaging 0.94
R6034:Cps1 UTSW 1 67157713 splice site probably null
R6034:Cps1 UTSW 1 67157713 splice site probably null
R6199:Cps1 UTSW 1 67162615 frame shift probably null
R6310:Cps1 UTSW 1 67142981 missense probably benign 0.00
R6554:Cps1 UTSW 1 67174469 nonsense probably null
R6700:Cps1 UTSW 1 67229523 splice site probably null
R6731:Cps1 UTSW 1 67160871 missense probably damaging 0.96
R7052:Cps1 UTSW 1 67198410 missense probably damaging 1.00
R7278:Cps1 UTSW 1 67170921 missense probably damaging 1.00
R7313:Cps1 UTSW 1 67198358 missense probably damaging 0.99
R7323:Cps1 UTSW 1 67157869 missense probably benign 0.03
R7339:Cps1 UTSW 1 67197015 missense possibly damaging 0.64
R7485:Cps1 UTSW 1 67139857 missense probably damaging 1.00
R7505:Cps1 UTSW 1 67180081 missense probably benign
R7748:Cps1 UTSW 1 67139806 missense probably damaging 1.00
R7853:Cps1 UTSW 1 67174481 missense possibly damaging 0.92
R8097:Cps1 UTSW 1 67228270 missense probably benign 0.08
R8357:Cps1 UTSW 1 67156854 missense probably damaging 1.00
R8435:Cps1 UTSW 1 67212430 missense probably benign 0.07
R8457:Cps1 UTSW 1 67156854 missense probably damaging 1.00
R8680:Cps1 UTSW 1 67204613 missense probably damaging 1.00
R8811:Cps1 UTSW 1 67214087 missense probably benign 0.03
R8819:Cps1 UTSW 1 67228280 missense possibly damaging 0.56
R8820:Cps1 UTSW 1 67228280 missense possibly damaging 0.56
R8854:Cps1 UTSW 1 67160889 missense probably damaging 1.00
R9138:Cps1 UTSW 1 67215410 missense probably damaging 1.00
R9185:Cps1 UTSW 1 67209672 missense probably benign 0.08
R9273:Cps1 UTSW 1 67152286 missense possibly damaging 0.69
R9286:Cps1 UTSW 1 67158871 missense probably damaging 0.99
R9308:Cps1 UTSW 1 67160959 critical splice donor site probably null
R9326:Cps1 UTSW 1 67209636 missense probably damaging 1.00
R9449:Cps1 UTSW 1 67220512 missense probably damaging 0.99
R9454:Cps1 UTSW 1 67180152 missense probably damaging 0.97
R9518:Cps1 UTSW 1 67220503 missense probably damaging 1.00
R9564:Cps1 UTSW 1 67158889 missense probably benign 0.26
R9585:Cps1 UTSW 1 67156182 missense probably damaging 0.99
R9618:Cps1 UTSW 1 67157816 missense possibly damaging 0.87
R9641:Cps1 UTSW 1 67195183 missense probably benign 0.03
R9650:Cps1 UTSW 1 67215477 missense
R9668:Cps1 UTSW 1 67174490 missense probably benign 0.24
R9726:Cps1 UTSW 1 67156236 missense probably benign 0.39
X0024:Cps1 UTSW 1 67123247 missense probably benign
Z1176:Cps1 UTSW 1 67123268 missense possibly damaging 0.54
Z1176:Cps1 UTSW 1 67148719 frame shift probably null
Predicted Primers PCR Primer
(F):5'- CGACTAGGGAACAGAAGCTC -3'
(R):5'- GGTCAGAAGGCACCTCGAAAAC -3'

Sequencing Primer
(F):5'- CTAGGGAACAGAAGCTCAAAATCTG -3'
(R):5'- CCTCGAAAACACTGGGCTGTTTG -3'
Posted On 2021-04-30