Incidental Mutation 'R8805:Morn5'
ID671972
Institutional Source Beutler Lab
Gene Symbol Morn5
Ensembl Gene ENSMUSG00000026894
Gene NameMORN repeat containing 5
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.111) question?
Stock #R8805 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location36049458-36079718 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 36079521 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 149 (D149G)
Ref Sequence ENSEMBL: ENSMUSP00000028256 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028256] [ENSMUST00000112960] [ENSMUST00000112961] [ENSMUST00000112963] [ENSMUST00000112966] [ENSMUST00000112967] [ENSMUST00000136821] [ENSMUST00000148852]
Predicted Effect probably benign
Transcript: ENSMUST00000028256
AA Change: D149G

PolyPhen 2 Score 0.280 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000028256
Gene: ENSMUSG00000026894
AA Change: D149G

DomainStartEndE-ValueType
MORN 6 27 1.24e1 SMART
MORN 29 50 3.61e-2 SMART
Pfam:MORN 54 75 2e-4 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112960
SMART Domains Protein: ENSMUSP00000108584
Gene: ENSMUSG00000026890

DomainStartEndE-ValueType
low complexity region 71 94 N/A INTRINSIC
LIM 98 151 7.34e-13 SMART
LIM 159 213 3.17e-17 SMART
HOX 248 310 1.1e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112961
SMART Domains Protein: ENSMUSP00000108585
Gene: ENSMUSG00000026890

DomainStartEndE-ValueType
low complexity region 42 65 N/A INTRINSIC
LIM 69 122 7.34e-13 SMART
LIM 130 184 3.17e-17 SMART
HOX 219 281 1.1e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112963
SMART Domains Protein: ENSMUSP00000108587
Gene: ENSMUSG00000026890

DomainStartEndE-ValueType
low complexity region 42 65 N/A INTRINSIC
LIM 69 122 7.34e-13 SMART
LIM 130 184 3.17e-17 SMART
HOX 219 281 1.1e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112966
SMART Domains Protein: ENSMUSP00000108590
Gene: ENSMUSG00000026890

DomainStartEndE-ValueType
low complexity region 42 65 N/A INTRINSIC
LIM 69 122 7.34e-13 SMART
LIM 130 184 3.17e-17 SMART
HOX 219 281 1.1e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112967
SMART Domains Protein: ENSMUSP00000108591
Gene: ENSMUSG00000026890

DomainStartEndE-ValueType
low complexity region 71 94 N/A INTRINSIC
LIM 98 151 7.34e-13 SMART
LIM 159 213 3.17e-17 SMART
HOX 248 310 1.1e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000136821
SMART Domains Protein: ENSMUSP00000135776
Gene: ENSMUSG00000026890

DomainStartEndE-ValueType
LIM 10 64 3.17e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000148852
SMART Domains Protein: ENSMUSP00000135693
Gene: ENSMUSG00000026890

DomainStartEndE-ValueType
low complexity region 42 65 N/A INTRINSIC
LIM 69 122 7.34e-13 SMART
LIM 130 184 3.17e-17 SMART
HOX 219 281 1.1e-23 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik G A 17: 9,007,905 W467* probably null Het
Actl6b G A 5: 137,554,656 M82I probably benign Het
Bmp2 T A 2: 133,561,334 D268E probably damaging Het
C530008M17Rik T C 5: 76,858,642 V950A unknown Het
Cacng7 T A 7: 3,366,782 L221H probably damaging Het
Ccser2 A G 14: 36,879,755 V224A probably damaging Het
Cdc40 A G 10: 40,857,580 F125L probably damaging Het
Cfap46 C T 7: 139,632,063 A1669T unknown Het
Cfap58 A T 19: 47,953,096 E301V probably damaging Het
Clcn2 C A 16: 20,713,418 G96C probably damaging Het
Cps1 G A 1: 67,176,951 A812T probably damaging Het
Crnkl1 T C 2: 145,931,430 probably null Het
Cry1 A G 10: 85,157,105 V83A probably benign Het
Cyp2a5 G T 7: 26,841,105 R381L probably damaging Het
Cyp46a1 T C 12: 108,361,203 F425L probably damaging Het
Dek A T 13: 47,099,454 N158K unknown Het
Dgcr8 T A 16: 18,258,297 Q674L probably damaging Het
Dlec1 C A 9: 119,112,582 S345R probably benign Het
Dnah7b T A 1: 46,234,145 C2478S possibly damaging Het
Dnah8 CGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTT CGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTT 17: 30,760,867 probably null Het
Dstyk T A 1: 132,434,225 L131Q probably damaging Het
Fbxw7 T A 3: 84,954,920 L186M Het
Fn1 T C 1: 71,605,080 Q1684R probably benign Het
Fsip2 C A 2: 82,983,109 H3257Q possibly damaging Het
Gm5773 T C 3: 93,773,735 V238A probably damaging Het
Gm9611 T C 14: 42,294,700 D131G Het
Gpatch8 T C 11: 102,480,192 E840G unknown Het
Grm5 G A 7: 87,803,968 R271Q probably damaging Het
Has3 A T 8: 106,874,503 Y199F probably damaging Het
Hmcn2 A G 2: 31,425,381 N3714S probably benign Het
Idh1 CA CAA 1: 65,165,188 probably null Het
Il2 T A 3: 37,123,133 T85S possibly damaging Het
Kank4 T C 4: 98,780,036 H58R possibly damaging Het
Kcnk4 T A 19: 6,928,011 I154F probably damaging Het
Krt2 T C 15: 101,815,944 K295R possibly damaging Het
Lipm A T 19: 34,112,908 D163V probably damaging Het
Lpl A G 8: 68,887,563 N70S probably damaging Het
Mnd1 T A 3: 84,088,125 E187D probably benign Het
Mrrf G A 2: 36,147,953 V79I probably damaging Het
Msh4 T A 3: 153,857,633 Q896L probably benign Het
Mtus2 A C 5: 148,078,493 M699L possibly damaging Het
Mycbp T A 4: 123,910,087 C130S unknown Het
Ntn5 A T 7: 45,684,475 Y4F probably benign Het
Olfr868 T C 9: 20,101,284 V175A probably benign Het
Osm A G 11: 4,239,839 S208G probably benign Het
Pcsk6 T A 7: 65,929,143 Y222N possibly damaging Het
Pde6a A G 18: 61,257,033 E486G probably benign Het
Pdzk1 T A 3: 96,851,594 L105Q possibly damaging Het
Prkd1 T A 12: 50,388,373 S524C probably damaging Het
Prkd1 C G 12: 50,388,372 S524T probably benign Het
Rab4b T C 7: 27,174,723 I90V Het
Rc3h1 T C 1: 160,967,652 V1083A probably benign Het
Rfx7 C T 9: 72,617,034 T502I probably benign Het
Rtn4rl2 T C 2: 84,872,214 Y332C probably damaging Het
Senp2 A G 16: 22,028,039 T265A probably benign Het
Slc38a3 T C 9: 107,655,146 M396V probably benign Het
Sord G A 2: 122,264,126 V332I probably benign Het
Sprr1b GTGGCAGGGCTCAGGAGCCTTGGGGTGGCAGGGCTCAGGAGCCTTGGGATGGCAGGGCTCAGGAGCCTTGGGGTGGCAGGGCTCAGGA GTGGCAGGGCTCAGGAGCCTTGGGGTGGCAGGGCTCAGGA 3: 92,437,346 probably benign Het
Star G A 8: 25,809,549 R53H probably benign Het
Stard4 T G 18: 33,203,696 I189L possibly damaging Het
Stk38 G T 17: 29,000,120 T7K probably benign Het
Stxbp5 T A 10: 9,838,115 K227* probably null Het
Taf4b C T 18: 14,813,428 P436L possibly damaging Het
Tgm3 T A 2: 130,047,782 V632E probably damaging Het
Tmem158 A G 9: 123,260,244 F101S probably damaging Het
Trmt10b T C 4: 45,301,281 S77P probably benign Het
Ttn A T 2: 76,889,963 L6973* probably null Het
Tubal3 T C 13: 3,933,293 F358L probably damaging Het
Vmn1r214 C T 13: 23,035,103 L256F possibly damaging Het
Vmn2r86 A G 10: 130,446,527 V740A probably benign Het
Yipf1 A T 4: 107,336,158 E80D probably benign Het
Zcchc11 T C 4: 108,549,378 V1381A possibly damaging Het
Zdhhc2 G T 8: 40,445,805 probably null Het
Zfp655 C T 5: 145,244,480 H383Y probably damaging Het
Other mutations in Morn5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02158:Morn5 APN 2 36057076 missense probably damaging 1.00
IGL02190:Morn5 APN 2 36079515 missense probably benign 0.03
IGL02441:Morn5 APN 2 36055026 nonsense probably null
IGL02899:Morn5 APN 2 36055037 missense probably damaging 1.00
R0306:Morn5 UTSW 2 36054974 missense probably damaging 1.00
R1449:Morn5 UTSW 2 36057080 nonsense probably null
R1803:Morn5 UTSW 2 36053077 missense probably benign 0.03
R1819:Morn5 UTSW 2 36052975 missense probably damaging 1.00
R2012:Morn5 UTSW 2 36052938 missense probably benign 0.03
R3932:Morn5 UTSW 2 36053023 missense probably damaging 0.99
R7078:Morn5 UTSW 2 36054978 missense probably benign
R7681:Morn5 UTSW 2 36057144 missense possibly damaging 0.95
R7938:Morn5 UTSW 2 36057070 missense probably benign 0.03
R8438:Morn5 UTSW 2 36055064 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TCTAACTCAGAGGTCAGTGTCC -3'
(R):5'- GGCTGTTCAGTGCAGAAAAC -3'

Sequencing Primer
(F):5'- TGCCTAGCCACTCTGCTGAG -3'
(R):5'- CTGTTCAGTGCAGAAAACCTTTATTC -3'
Posted On2021-04-30