Incidental Mutation 'R8805:Il2'
ID 671981
Institutional Source Beutler Lab
Gene Symbol Il2
Ensembl Gene ENSMUSG00000027720
Gene Name interleukin 2
Synonyms IL-2
MMRRC Submission 068642-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8805 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 37174862-37180103 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 37177282 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 85 (T85S)
Ref Sequence ENSEMBL: ENSMUSP00000029275 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029275]
AlphaFold P04351
Predicted Effect possibly damaging
Transcript: ENSMUST00000029275
AA Change: T85S

PolyPhen 2 Score 0.780 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000029275
Gene: ENSMUSG00000027720
AA Change: T85S

DomainStartEndE-ValueType
IL2 1 168 4.75e-134 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000147773
SMART Domains Protein: ENSMUSP00000121015
Gene: ENSMUSG00000027719

DomainStartEndE-ValueType
Pfam:A_deamin 1 176 1.3e-49 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 96% (70/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a secreted cytokine that is important for the proliferation of T and B lymphocytes. The receptor of this cytokine is a heterotrimeric protein complex whose gamma chain is also shared by interleukin 4 (IL4) and interleukin 7 (IL7). The expression of this gene in mature thymocytes is monoallelic, which represents an unusual regulatory mode for controlling the precise expression of a single gene. The targeted disruption of a similar gene in mice leads to ulcerative colitis-like disease, which suggests an essential role of this gene in the immune response to antigenic stimuli. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants develop adult onset autoimmune disease, with 50% mortality by 9 weeks due to hemolytic anemia. Survivors develop inflammatory bowl disease/colitis. Immune system dysregulation and CD4+ T-cell overproduction may be responsible. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik G A 17: 9,226,737 (GRCm39) W467* probably null Het
4921509C19Rik A T 2: 151,313,285 (GRCm39) probably benign Het
Actl6b G A 5: 137,552,918 (GRCm39) M82I probably benign Het
Bmp2 T A 2: 133,403,254 (GRCm39) D268E probably damaging Het
Cacng7 T A 7: 3,415,298 (GRCm39) L221H probably damaging Het
Ccser2 A G 14: 36,601,712 (GRCm39) V224A probably damaging Het
Cdc40 A G 10: 40,733,576 (GRCm39) F125L probably damaging Het
Cfap46 C T 7: 139,211,979 (GRCm39) A1669T unknown Het
Cfap58 A T 19: 47,941,535 (GRCm39) E301V probably damaging Het
Clcn2 C A 16: 20,532,168 (GRCm39) G96C probably damaging Het
Cotl1 T A 8: 120,536,944 (GRCm39) probably benign Het
Cps1 G A 1: 67,216,110 (GRCm39) A812T probably damaging Het
Cracd T C 5: 77,006,489 (GRCm39) V950A unknown Het
Crnkl1 T C 2: 145,773,350 (GRCm39) probably null Het
Cry1 A G 10: 84,992,969 (GRCm39) V83A probably benign Het
Cyp2a5 G T 7: 26,540,530 (GRCm39) R381L probably damaging Het
Cyp46a1 T C 12: 108,327,462 (GRCm39) F425L probably damaging Het
Dek A T 13: 47,252,930 (GRCm39) N158K unknown Het
Dgcr8 T A 16: 18,076,161 (GRCm39) Q674L probably damaging Het
Dlec1 C A 9: 118,941,650 (GRCm39) S345R probably benign Het
Dnah7b T A 1: 46,273,305 (GRCm39) C2478S possibly damaging Het
Dstyk T A 1: 132,361,963 (GRCm39) L131Q probably damaging Het
Fbxw7 T A 3: 84,862,227 (GRCm39) L186M Het
Fn1 T C 1: 71,644,239 (GRCm39) Q1684R probably benign Het
Fsip2 C A 2: 82,813,453 (GRCm39) H3257Q possibly damaging Het
Gm5773 T C 3: 93,681,042 (GRCm39) V238A probably damaging Het
Gm9611 T C 14: 42,116,657 (GRCm39) D131G Het
Gpatch8 T C 11: 102,371,018 (GRCm39) E840G unknown Het
Grm5 G A 7: 87,453,176 (GRCm39) R271Q probably damaging Het
Has3 A T 8: 107,601,135 (GRCm39) Y199F probably damaging Het
Hmcn2 A G 2: 31,315,393 (GRCm39) N3714S probably benign Het
Idh1 CA CAA 1: 65,204,347 (GRCm39) probably null Het
Kank4 T C 4: 98,668,273 (GRCm39) H58R possibly damaging Het
Kcnk4 T A 19: 6,905,379 (GRCm39) I154F probably damaging Het
Krt1c T C 15: 101,724,379 (GRCm39) K295R possibly damaging Het
Lipm A T 19: 34,090,308 (GRCm39) D163V probably damaging Het
Lpl A G 8: 69,340,215 (GRCm39) N70S probably damaging Het
Mgme1 A G 2: 144,114,451 (GRCm39) probably benign Het
Mnd1 T A 3: 83,995,432 (GRCm39) E187D probably benign Het
Morn5 A G 2: 35,969,533 (GRCm39) D149G probably benign Het
Mrrf G A 2: 36,037,965 (GRCm39) V79I probably damaging Het
Msh4 T A 3: 153,563,270 (GRCm39) Q896L probably benign Het
Mtus2 A C 5: 148,015,303 (GRCm39) M699L possibly damaging Het
Mycbp T A 4: 123,803,880 (GRCm39) C130S unknown Het
Ntn5 A T 7: 45,333,899 (GRCm39) Y4F probably benign Het
Or7e174 T C 9: 20,012,580 (GRCm39) V175A probably benign Het
Osm A G 11: 4,189,839 (GRCm39) S208G probably benign Het
Pcsk6 T A 7: 65,578,891 (GRCm39) Y222N possibly damaging Het
Pde6a A G 18: 61,390,104 (GRCm39) E486G probably benign Het
Pdzk1 T A 3: 96,758,910 (GRCm39) L105Q possibly damaging Het
Prkd1 C G 12: 50,435,155 (GRCm39) S524T probably benign Het
Prkd1 T A 12: 50,435,156 (GRCm39) S524C probably damaging Het
Rab4b T C 7: 26,874,148 (GRCm39) I90V Het
Rc3h1 T C 1: 160,795,222 (GRCm39) V1083A probably benign Het
Rfx7 C T 9: 72,524,316 (GRCm39) T502I probably benign Het
Rtn4rl2 T C 2: 84,702,558 (GRCm39) Y332C probably damaging Het
Senp2 A G 16: 21,846,789 (GRCm39) T265A probably benign Het
Slc38a3 T C 9: 107,532,345 (GRCm39) M396V probably benign Het
Sord G A 2: 122,094,607 (GRCm39) V332I probably benign Het
Sprr1b GTGGCAGGGCTCAGGAGCCTTGGGGTGGCAGGGCTCAGGAGCCTTGGGATGGCAGGGCTCAGGAGCCTTGGGGTGGCAGGGCTCAGGA GTGGCAGGGCTCAGGAGCCTTGGGGTGGCAGGGCTCAGGA 3: 92,344,653 (GRCm39) probably benign Het
Star G A 8: 26,299,577 (GRCm39) R53H probably benign Het
Stard4 T G 18: 33,336,749 (GRCm39) I189L possibly damaging Het
Stk38 G T 17: 29,219,094 (GRCm39) T7K probably benign Het
Stxbp5 T A 10: 9,713,859 (GRCm39) K227* probably null Het
Taf4b C T 18: 14,946,485 (GRCm39) P436L possibly damaging Het
Tgm3 T A 2: 129,889,702 (GRCm39) V632E probably damaging Het
Tmem158 A G 9: 123,089,309 (GRCm39) F101S probably damaging Het
Trmt10b T C 4: 45,301,281 (GRCm39) S77P probably benign Het
Ttn A T 2: 76,720,307 (GRCm39) L6973* probably null Het
Tubal3 T C 13: 3,983,293 (GRCm39) F358L probably damaging Het
Tut4 T C 4: 108,406,575 (GRCm39) V1381A possibly damaging Het
Vmn1r214 C T 13: 23,219,273 (GRCm39) L256F possibly damaging Het
Vmn2r86 A G 10: 130,282,396 (GRCm39) V740A probably benign Het
Yipf1 A T 4: 107,193,355 (GRCm39) E80D probably benign Het
Zdhhc2 G T 8: 40,898,846 (GRCm39) probably null Het
Zfp655 C T 5: 145,181,290 (GRCm39) H383Y probably damaging Het
Zfp981 C T 4: 146,622,410 (GRCm39) T445I possibly damaging Het
Other mutations in Il2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01518:Il2 APN 3 37,177,156 (GRCm39) missense possibly damaging 0.64
IGL02047:Il2 APN 3 37,180,000 (GRCm39) missense probably benign 0.01
FR4304:Il2 UTSW 3 37,179,975 (GRCm39) unclassified probably benign
FR4737:Il2 UTSW 3 37,179,977 (GRCm39) unclassified probably benign
FR4737:Il2 UTSW 3 37,179,913 (GRCm39) unclassified probably benign
FR4976:Il2 UTSW 3 37,179,978 (GRCm39) unclassified probably benign
R9287:Il2 UTSW 3 37,179,988 (GRCm39) missense probably damaging 0.99
RF001:Il2 UTSW 3 37,179,911 (GRCm39) unclassified probably benign
RF023:Il2 UTSW 3 37,179,969 (GRCm39) unclassified probably benign
RF029:Il2 UTSW 3 37,179,976 (GRCm39) unclassified probably benign
RF030:Il2 UTSW 3 37,179,991 (GRCm39) unclassified probably benign
RF030:Il2 UTSW 3 37,179,976 (GRCm39) unclassified probably benign
RF033:Il2 UTSW 3 37,179,991 (GRCm39) unclassified probably benign
RF033:Il2 UTSW 3 37,179,913 (GRCm39) unclassified probably benign
RF036:Il2 UTSW 3 37,179,976 (GRCm39) unclassified probably benign
RF038:Il2 UTSW 3 37,179,970 (GRCm39) nonsense probably null
RF039:Il2 UTSW 3 37,179,991 (GRCm39) unclassified probably benign
RF041:Il2 UTSW 3 37,179,991 (GRCm39) unclassified probably benign
RF043:Il2 UTSW 3 37,179,991 (GRCm39) unclassified probably benign
RF051:Il2 UTSW 3 37,179,990 (GRCm39) unclassified probably benign
RF058:Il2 UTSW 3 37,179,966 (GRCm39) unclassified probably benign
RF058:Il2 UTSW 3 37,179,970 (GRCm39) unclassified probably benign
RF061:Il2 UTSW 3 37,179,990 (GRCm39) unclassified probably benign
RF064:Il2 UTSW 3 37,179,913 (GRCm39) unclassified probably benign
Predicted Primers PCR Primer
(F):5'- GGCTGACTAAATGCACAGAACC -3'
(R):5'- GTGGCCTAACAGTCAAGGTG -3'

Sequencing Primer
(F):5'- GGCAAGCCACTTAAAAATGCATTTC -3'
(R):5'- CCCTTATGGTTGTGAGCTCTTGC -3'
Posted On 2021-04-30