Incidental Mutation 'R8805:Il2'
ID 671981
Institutional Source Beutler Lab
Gene Symbol Il2
Ensembl Gene ENSMUSG00000027720
Gene Name interleukin 2
Synonyms IL-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8805 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 37120523-37125959 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 37123133 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 85 (T85S)
Ref Sequence ENSEMBL: ENSMUSP00000029275 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029275]
AlphaFold P04351
Predicted Effect possibly damaging
Transcript: ENSMUST00000029275
AA Change: T85S

PolyPhen 2 Score 0.780 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000029275
Gene: ENSMUSG00000027720
AA Change: T85S

DomainStartEndE-ValueType
IL2 1 168 4.75e-134 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000147773
SMART Domains Protein: ENSMUSP00000121015
Gene: ENSMUSG00000027719

DomainStartEndE-ValueType
Pfam:A_deamin 1 176 1.3e-49 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 96% (70/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a secreted cytokine that is important for the proliferation of T and B lymphocytes. The receptor of this cytokine is a heterotrimeric protein complex whose gamma chain is also shared by interleukin 4 (IL4) and interleukin 7 (IL7). The expression of this gene in mature thymocytes is monoallelic, which represents an unusual regulatory mode for controlling the precise expression of a single gene. The targeted disruption of a similar gene in mice leads to ulcerative colitis-like disease, which suggests an essential role of this gene in the immune response to antigenic stimuli. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants develop adult onset autoimmune disease, with 50% mortality by 9 weeks due to hemolytic anemia. Survivors develop inflammatory bowl disease/colitis. Immune system dysregulation and CD4+ T-cell overproduction may be responsible. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik G A 17: 9,007,905 W467* probably null Het
4921509C19Rik A T 2: 151,471,365 probably benign Het
Actl6b G A 5: 137,554,656 M82I probably benign Het
Bmp2 T A 2: 133,561,334 D268E probably damaging Het
C530008M17Rik T C 5: 76,858,642 V950A unknown Het
Cacng7 T A 7: 3,366,782 L221H probably damaging Het
Ccser2 A G 14: 36,879,755 V224A probably damaging Het
Cdc40 A G 10: 40,857,580 F125L probably damaging Het
Cfap46 C T 7: 139,632,063 A1669T unknown Het
Cfap58 A T 19: 47,953,096 E301V probably damaging Het
Clcn2 C A 16: 20,713,418 G96C probably damaging Het
Cotl1 T A 8: 119,810,205 probably benign Het
Cps1 G A 1: 67,176,951 A812T probably damaging Het
Crnkl1 T C 2: 145,931,430 probably null Het
Cry1 A G 10: 85,157,105 V83A probably benign Het
Cyp2a5 G T 7: 26,841,105 R381L probably damaging Het
Cyp46a1 T C 12: 108,361,203 F425L probably damaging Het
Dek A T 13: 47,099,454 N158K unknown Het
Dgcr8 T A 16: 18,258,297 Q674L probably damaging Het
Dlec1 C A 9: 119,112,582 S345R probably benign Het
Dnah7b T A 1: 46,234,145 C2478S possibly damaging Het
Dstyk T A 1: 132,434,225 L131Q probably damaging Het
Fbxw7 T A 3: 84,954,920 L186M Het
Fn1 T C 1: 71,605,080 Q1684R probably benign Het
Fsip2 C A 2: 82,983,109 H3257Q possibly damaging Het
Gm5773 T C 3: 93,773,735 V238A probably damaging Het
Gm9611 T C 14: 42,294,700 D131G Het
Gpatch8 T C 11: 102,480,192 E840G unknown Het
Grm5 G A 7: 87,803,968 R271Q probably damaging Het
Has3 A T 8: 106,874,503 Y199F probably damaging Het
Hmcn2 A G 2: 31,425,381 N3714S probably benign Het
Idh1 CA CAA 1: 65,165,188 probably null Het
Kank4 T C 4: 98,780,036 H58R possibly damaging Het
Kcnk4 T A 19: 6,928,011 I154F probably damaging Het
Krt2 T C 15: 101,815,944 K295R possibly damaging Het
Lipm A T 19: 34,112,908 D163V probably damaging Het
Lpl A G 8: 68,887,563 N70S probably damaging Het
Mgme1 A G 2: 144,272,531 probably benign Het
Mnd1 T A 3: 84,088,125 E187D probably benign Het
Morn5 A G 2: 36,079,521 D149G probably benign Het
Mrrf G A 2: 36,147,953 V79I probably damaging Het
Msh4 T A 3: 153,857,633 Q896L probably benign Het
Mtus2 A C 5: 148,078,493 M699L possibly damaging Het
Mycbp T A 4: 123,910,087 C130S unknown Het
Ntn5 A T 7: 45,684,475 Y4F probably benign Het
Olfr868 T C 9: 20,101,284 V175A probably benign Het
Osm A G 11: 4,239,839 S208G probably benign Het
Pcsk6 T A 7: 65,929,143 Y222N possibly damaging Het
Pde6a A G 18: 61,257,033 E486G probably benign Het
Pdzk1 T A 3: 96,851,594 L105Q possibly damaging Het
Prkd1 C G 12: 50,388,372 S524T probably benign Het
Prkd1 T A 12: 50,388,373 S524C probably damaging Het
Rab4b T C 7: 27,174,723 I90V Het
Rc3h1 T C 1: 160,967,652 V1083A probably benign Het
Rfx7 C T 9: 72,617,034 T502I probably benign Het
Rtn4rl2 T C 2: 84,872,214 Y332C probably damaging Het
Senp2 A G 16: 22,028,039 T265A probably benign Het
Slc38a3 T C 9: 107,655,146 M396V probably benign Het
Sord G A 2: 122,264,126 V332I probably benign Het
Sprr1b GTGGCAGGGCTCAGGAGCCTTGGGGTGGCAGGGCTCAGGAGCCTTGGGATGGCAGGGCTCAGGAGCCTTGGGGTGGCAGGGCTCAGGA GTGGCAGGGCTCAGGAGCCTTGGGGTGGCAGGGCTCAGGA 3: 92,437,346 probably benign Het
Star G A 8: 25,809,549 R53H probably benign Het
Stard4 T G 18: 33,203,696 I189L possibly damaging Het
Stk38 G T 17: 29,000,120 T7K probably benign Het
Stxbp5 T A 10: 9,838,115 K227* probably null Het
Taf4b C T 18: 14,813,428 P436L possibly damaging Het
Tgm3 T A 2: 130,047,782 V632E probably damaging Het
Tmem158 A G 9: 123,260,244 F101S probably damaging Het
Trmt10b T C 4: 45,301,281 S77P probably benign Het
Ttn A T 2: 76,889,963 L6973* probably null Het
Tubal3 T C 13: 3,933,293 F358L probably damaging Het
Vmn1r214 C T 13: 23,035,103 L256F possibly damaging Het
Vmn2r86 A G 10: 130,446,527 V740A probably benign Het
Yipf1 A T 4: 107,336,158 E80D probably benign Het
Zcchc11 T C 4: 108,549,378 V1381A possibly damaging Het
Zdhhc2 G T 8: 40,445,805 probably null Het
Zfp655 C T 5: 145,244,480 H383Y probably damaging Het
Zfp981 C T 4: 146,537,953 T445I possibly damaging Het
Other mutations in Il2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01518:Il2 APN 3 37123007 missense possibly damaging 0.64
IGL02047:Il2 APN 3 37125851 missense probably benign 0.01
FR4304:Il2 UTSW 3 37125826 unclassified probably benign
FR4737:Il2 UTSW 3 37125764 unclassified probably benign
FR4737:Il2 UTSW 3 37125828 unclassified probably benign
FR4976:Il2 UTSW 3 37125829 unclassified probably benign
R9287:Il2 UTSW 3 37125839 missense probably damaging 0.99
RF001:Il2 UTSW 3 37125762 unclassified probably benign
RF023:Il2 UTSW 3 37125820 unclassified probably benign
RF029:Il2 UTSW 3 37125827 unclassified probably benign
RF030:Il2 UTSW 3 37125827 unclassified probably benign
RF030:Il2 UTSW 3 37125842 unclassified probably benign
RF033:Il2 UTSW 3 37125764 unclassified probably benign
RF033:Il2 UTSW 3 37125842 unclassified probably benign
RF036:Il2 UTSW 3 37125827 unclassified probably benign
RF038:Il2 UTSW 3 37125821 nonsense probably null
RF039:Il2 UTSW 3 37125842 unclassified probably benign
RF041:Il2 UTSW 3 37125842 unclassified probably benign
RF043:Il2 UTSW 3 37125842 unclassified probably benign
RF051:Il2 UTSW 3 37125841 unclassified probably benign
RF058:Il2 UTSW 3 37125817 unclassified probably benign
RF058:Il2 UTSW 3 37125821 unclassified probably benign
RF061:Il2 UTSW 3 37125841 unclassified probably benign
RF064:Il2 UTSW 3 37125764 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- GGCTGACTAAATGCACAGAACC -3'
(R):5'- GTGGCCTAACAGTCAAGGTG -3'

Sequencing Primer
(F):5'- GGCAAGCCACTTAAAAATGCATTTC -3'
(R):5'- CCCTTATGGTTGTGAGCTCTTGC -3'
Posted On 2021-04-30