Incidental Mutation 'R8805:Grm5'
ID 672002
Institutional Source Beutler Lab
Gene Symbol Grm5
Ensembl Gene ENSMUSG00000049583
Gene Name glutamate receptor, metabotropic 5
Synonyms mGluR5, 6430542K11Rik, Gprc1e, Glu5R
MMRRC Submission 068642-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.145) question?
Stock # R8805 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 87233376-87784115 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 87453176 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Glutamine at position 271 (R271Q)
Ref Sequence ENSEMBL: ENSMUSP00000114927 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107263] [ENSMUST00000125009] [ENSMUST00000155358]
AlphaFold Q3UVX5
Predicted Effect probably damaging
Transcript: ENSMUST00000107263
AA Change: R271Q

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000102884
Gene: ENSMUSG00000049583
AA Change: R271Q

DomainStartEndE-ValueType
low complexity region 2 12 N/A INTRINSIC
Pfam:ANF_receptor 67 471 5.4e-97 PFAM
Pfam:Peripla_BP_6 130 332 2.5e-14 PFAM
Pfam:NCD3G 506 557 4.5e-20 PFAM
Pfam:7tm_3 588 824 7.4e-75 PFAM
low complexity region 851 860 N/A INTRINSIC
low complexity region 929 954 N/A INTRINSIC
low complexity region 968 987 N/A INTRINSIC
low complexity region 1046 1056 N/A INTRINSIC
GluR_Homer-bdg 1121 1171 1.42e-24 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000125009
AA Change: R271Q

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000118393
Gene: ENSMUSG00000049583
AA Change: R271Q

DomainStartEndE-ValueType
low complexity region 2 12 N/A INTRINSIC
Pfam:ANF_receptor 67 471 5.7e-101 PFAM
Pfam:Peripla_BP_6 129 327 5.4e-12 PFAM
Pfam:NCD3G 506 557 3.2e-16 PFAM
Pfam:7tm_3 590 823 3.5e-56 PFAM
low complexity region 851 860 N/A INTRINSIC
low complexity region 929 954 N/A INTRINSIC
low complexity region 968 987 N/A INTRINSIC
low complexity region 1046 1056 N/A INTRINSIC
GluR_Homer-bdg 1121 1171 1.42e-24 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000155358
AA Change: R271Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114927
Gene: ENSMUSG00000049583
AA Change: R271Q

DomainStartEndE-ValueType
low complexity region 2 12 N/A INTRINSIC
Pfam:ANF_receptor 67 471 4.1e-101 PFAM
Pfam:Peripla_BP_6 129 327 2.5e-12 PFAM
Pfam:NCD3G 506 557 9.4e-17 PFAM
Pfam:7tm_3 590 823 1.3e-56 PFAM
low complexity region 851 860 N/A INTRINSIC
low complexity region 961 986 N/A INTRINSIC
low complexity region 1000 1019 N/A INTRINSIC
low complexity region 1078 1088 N/A INTRINSIC
GluR_Homer-bdg 1153 1203 1.42e-24 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 96% (70/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the G-protein coupled receptor 3 protein family. The encoded protein is a metabatropic glutamate receptor, whose signaling activates a phosphatidylinositol-calcium second messenger system. This protein may be involved in the regulation of neural network activity and synaptic plasticity. Glutamatergic neurotransmission is involved in most aspects of normal brain function and can be perturbed in many neuropathologic conditions. A pseudogene of this gene has been defined on chromosome 11. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2014]
PHENOTYPE: Homozygous null mice have reduced corticostriatal long term potentiation, do not exhibit hyperactivity after cocaine consumption and do not self-administer cocaine. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik G A 17: 9,226,737 (GRCm39) W467* probably null Het
4921509C19Rik A T 2: 151,313,285 (GRCm39) probably benign Het
Actl6b G A 5: 137,552,918 (GRCm39) M82I probably benign Het
Bmp2 T A 2: 133,403,254 (GRCm39) D268E probably damaging Het
Cacng7 T A 7: 3,415,298 (GRCm39) L221H probably damaging Het
Ccser2 A G 14: 36,601,712 (GRCm39) V224A probably damaging Het
Cdc40 A G 10: 40,733,576 (GRCm39) F125L probably damaging Het
Cfap46 C T 7: 139,211,979 (GRCm39) A1669T unknown Het
Cfap58 A T 19: 47,941,535 (GRCm39) E301V probably damaging Het
Clcn2 C A 16: 20,532,168 (GRCm39) G96C probably damaging Het
Cotl1 T A 8: 120,536,944 (GRCm39) probably benign Het
Cps1 G A 1: 67,216,110 (GRCm39) A812T probably damaging Het
Cracd T C 5: 77,006,489 (GRCm39) V950A unknown Het
Crnkl1 T C 2: 145,773,350 (GRCm39) probably null Het
Cry1 A G 10: 84,992,969 (GRCm39) V83A probably benign Het
Cyp2a5 G T 7: 26,540,530 (GRCm39) R381L probably damaging Het
Cyp46a1 T C 12: 108,327,462 (GRCm39) F425L probably damaging Het
Dek A T 13: 47,252,930 (GRCm39) N158K unknown Het
Dgcr8 T A 16: 18,076,161 (GRCm39) Q674L probably damaging Het
Dlec1 C A 9: 118,941,650 (GRCm39) S345R probably benign Het
Dnah7b T A 1: 46,273,305 (GRCm39) C2478S possibly damaging Het
Dstyk T A 1: 132,361,963 (GRCm39) L131Q probably damaging Het
Fbxw7 T A 3: 84,862,227 (GRCm39) L186M Het
Fn1 T C 1: 71,644,239 (GRCm39) Q1684R probably benign Het
Fsip2 C A 2: 82,813,453 (GRCm39) H3257Q possibly damaging Het
Gm5773 T C 3: 93,681,042 (GRCm39) V238A probably damaging Het
Gm9611 T C 14: 42,116,657 (GRCm39) D131G Het
Gpatch8 T C 11: 102,371,018 (GRCm39) E840G unknown Het
Has3 A T 8: 107,601,135 (GRCm39) Y199F probably damaging Het
Hmcn2 A G 2: 31,315,393 (GRCm39) N3714S probably benign Het
Idh1 CA CAA 1: 65,204,347 (GRCm39) probably null Het
Il2 T A 3: 37,177,282 (GRCm39) T85S possibly damaging Het
Kank4 T C 4: 98,668,273 (GRCm39) H58R possibly damaging Het
Kcnk4 T A 19: 6,905,379 (GRCm39) I154F probably damaging Het
Krt1c T C 15: 101,724,379 (GRCm39) K295R possibly damaging Het
Lipm A T 19: 34,090,308 (GRCm39) D163V probably damaging Het
Lpl A G 8: 69,340,215 (GRCm39) N70S probably damaging Het
Mgme1 A G 2: 144,114,451 (GRCm39) probably benign Het
Mnd1 T A 3: 83,995,432 (GRCm39) E187D probably benign Het
Morn5 A G 2: 35,969,533 (GRCm39) D149G probably benign Het
Mrrf G A 2: 36,037,965 (GRCm39) V79I probably damaging Het
Msh4 T A 3: 153,563,270 (GRCm39) Q896L probably benign Het
Mtus2 A C 5: 148,015,303 (GRCm39) M699L possibly damaging Het
Mycbp T A 4: 123,803,880 (GRCm39) C130S unknown Het
Ntn5 A T 7: 45,333,899 (GRCm39) Y4F probably benign Het
Or7e174 T C 9: 20,012,580 (GRCm39) V175A probably benign Het
Osm A G 11: 4,189,839 (GRCm39) S208G probably benign Het
Pcsk6 T A 7: 65,578,891 (GRCm39) Y222N possibly damaging Het
Pde6a A G 18: 61,390,104 (GRCm39) E486G probably benign Het
Pdzk1 T A 3: 96,758,910 (GRCm39) L105Q possibly damaging Het
Prkd1 C G 12: 50,435,155 (GRCm39) S524T probably benign Het
Prkd1 T A 12: 50,435,156 (GRCm39) S524C probably damaging Het
Rab4b T C 7: 26,874,148 (GRCm39) I90V Het
Rc3h1 T C 1: 160,795,222 (GRCm39) V1083A probably benign Het
Rfx7 C T 9: 72,524,316 (GRCm39) T502I probably benign Het
Rtn4rl2 T C 2: 84,702,558 (GRCm39) Y332C probably damaging Het
Senp2 A G 16: 21,846,789 (GRCm39) T265A probably benign Het
Slc38a3 T C 9: 107,532,345 (GRCm39) M396V probably benign Het
Sord G A 2: 122,094,607 (GRCm39) V332I probably benign Het
Sprr1b GTGGCAGGGCTCAGGAGCCTTGGGGTGGCAGGGCTCAGGAGCCTTGGGATGGCAGGGCTCAGGAGCCTTGGGGTGGCAGGGCTCAGGA GTGGCAGGGCTCAGGAGCCTTGGGGTGGCAGGGCTCAGGA 3: 92,344,653 (GRCm39) probably benign Het
Star G A 8: 26,299,577 (GRCm39) R53H probably benign Het
Stard4 T G 18: 33,336,749 (GRCm39) I189L possibly damaging Het
Stk38 G T 17: 29,219,094 (GRCm39) T7K probably benign Het
Stxbp5 T A 10: 9,713,859 (GRCm39) K227* probably null Het
Taf4b C T 18: 14,946,485 (GRCm39) P436L possibly damaging Het
Tgm3 T A 2: 129,889,702 (GRCm39) V632E probably damaging Het
Tmem158 A G 9: 123,089,309 (GRCm39) F101S probably damaging Het
Trmt10b T C 4: 45,301,281 (GRCm39) S77P probably benign Het
Ttn A T 2: 76,720,307 (GRCm39) L6973* probably null Het
Tubal3 T C 13: 3,983,293 (GRCm39) F358L probably damaging Het
Tut4 T C 4: 108,406,575 (GRCm39) V1381A possibly damaging Het
Vmn1r214 C T 13: 23,219,273 (GRCm39) L256F possibly damaging Het
Vmn2r86 A G 10: 130,282,396 (GRCm39) V740A probably benign Het
Yipf1 A T 4: 107,193,355 (GRCm39) E80D probably benign Het
Zdhhc2 G T 8: 40,898,846 (GRCm39) probably null Het
Zfp655 C T 5: 145,181,290 (GRCm39) H383Y probably damaging Het
Zfp981 C T 4: 146,622,410 (GRCm39) T445I possibly damaging Het
Other mutations in Grm5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Grm5 APN 7 87,779,989 (GRCm39) missense probably benign 0.00
IGL00970:Grm5 APN 7 87,453,104 (GRCm39) missense probably damaging 0.97
IGL01286:Grm5 APN 7 87,251,773 (GRCm39) missense probably benign 0.00
IGL01307:Grm5 APN 7 87,724,220 (GRCm39) missense probably damaging 1.00
IGL01603:Grm5 APN 7 87,252,386 (GRCm39) missense probably damaging 1.00
IGL01646:Grm5 APN 7 87,689,267 (GRCm39) missense probably damaging 1.00
IGL01705:Grm5 APN 7 87,779,254 (GRCm39) missense possibly damaging 0.59
IGL02184:Grm5 APN 7 87,675,650 (GRCm39) missense probably damaging 0.98
IGL02504:Grm5 APN 7 87,779,980 (GRCm39) missense probably benign
IGL02689:Grm5 APN 7 87,251,918 (GRCm39) missense probably damaging 1.00
IGL02725:Grm5 APN 7 87,723,873 (GRCm39) missense probably damaging 1.00
IGL02851:Grm5 APN 7 87,723,918 (GRCm39) missense probably damaging 0.98
IGL03106:Grm5 APN 7 87,685,278 (GRCm39) missense probably damaging 1.00
IGL03257:Grm5 APN 7 87,252,106 (GRCm39) missense possibly damaging 0.69
IGL03291:Grm5 APN 7 87,780,004 (GRCm39) missense probably damaging 1.00
BB004:Grm5 UTSW 7 87,685,382 (GRCm39) missense probably benign 0.16
BB014:Grm5 UTSW 7 87,685,382 (GRCm39) missense probably benign 0.16
R0078:Grm5 UTSW 7 87,724,185 (GRCm39) missense probably damaging 1.00
R0314:Grm5 UTSW 7 87,252,163 (GRCm39) missense probably damaging 0.97
R0318:Grm5 UTSW 7 87,252,175 (GRCm39) missense probably damaging 0.99
R0364:Grm5 UTSW 7 87,723,594 (GRCm39) missense probably damaging 1.00
R0380:Grm5 UTSW 7 87,723,584 (GRCm39) missense possibly damaging 0.92
R0454:Grm5 UTSW 7 87,779,997 (GRCm39) missense probably damaging 1.00
R0494:Grm5 UTSW 7 87,779,989 (GRCm39) missense probably benign 0.00
R0562:Grm5 UTSW 7 87,252,227 (GRCm39) missense probably damaging 1.00
R1695:Grm5 UTSW 7 87,685,311 (GRCm39) missense possibly damaging 0.47
R2012:Grm5 UTSW 7 87,724,080 (GRCm39) missense probably damaging 1.00
R2384:Grm5 UTSW 7 87,251,936 (GRCm39) missense probably damaging 1.00
R2510:Grm5 UTSW 7 87,685,299 (GRCm39) missense probably benign 0.21
R2870:Grm5 UTSW 7 87,251,930 (GRCm39) missense possibly damaging 0.85
R2870:Grm5 UTSW 7 87,251,930 (GRCm39) missense possibly damaging 0.85
R3861:Grm5 UTSW 7 87,779,202 (GRCm39) missense possibly damaging 0.94
R4451:Grm5 UTSW 7 87,724,340 (GRCm39) critical splice donor site probably null
R4626:Grm5 UTSW 7 87,779,361 (GRCm39) missense probably damaging 1.00
R4728:Grm5 UTSW 7 87,624,496 (GRCm39) missense probably damaging 1.00
R4914:Grm5 UTSW 7 87,779,337 (GRCm39) missense probably benign 0.00
R5122:Grm5 UTSW 7 87,724,028 (GRCm39) missense probably damaging 1.00
R5352:Grm5 UTSW 7 87,724,058 (GRCm39) missense probably damaging 1.00
R5361:Grm5 UTSW 7 87,723,704 (GRCm39) missense probably damaging 1.00
R5684:Grm5 UTSW 7 87,779,853 (GRCm39) missense probably benign
R5715:Grm5 UTSW 7 87,779,464 (GRCm39) missense probably benign 0.05
R5759:Grm5 UTSW 7 87,675,808 (GRCm39) missense probably damaging 0.96
R5844:Grm5 UTSW 7 87,453,232 (GRCm39) missense possibly damaging 0.88
R5889:Grm5 UTSW 7 87,252,281 (GRCm39) missense probably damaging 1.00
R6048:Grm5 UTSW 7 87,675,758 (GRCm39) missense probably damaging 1.00
R6145:Grm5 UTSW 7 87,675,809 (GRCm39) missense probably damaging 1.00
R6232:Grm5 UTSW 7 87,251,638 (GRCm39) unclassified probably benign
R6972:Grm5 UTSW 7 87,252,131 (GRCm39) missense probably benign 0.02
R7072:Grm5 UTSW 7 87,723,512 (GRCm39) missense probably damaging 1.00
R7258:Grm5 UTSW 7 87,723,914 (GRCm39) missense probably damaging 0.96
R7316:Grm5 UTSW 7 87,624,473 (GRCm39) missense probably benign
R7434:Grm5 UTSW 7 87,779,682 (GRCm39) missense probably benign 0.10
R7521:Grm5 UTSW 7 87,723,480 (GRCm39) missense possibly damaging 0.86
R7616:Grm5 UTSW 7 87,765,409 (GRCm39) missense probably benign
R7631:Grm5 UTSW 7 87,624,513 (GRCm39) missense probably damaging 1.00
R7655:Grm5 UTSW 7 87,779,459 (GRCm39) missense probably benign 0.00
R7656:Grm5 UTSW 7 87,779,459 (GRCm39) missense probably benign 0.00
R7739:Grm5 UTSW 7 87,779,266 (GRCm39) missense possibly damaging 0.46
R7897:Grm5 UTSW 7 87,780,069 (GRCm39) missense probably benign 0.14
R7927:Grm5 UTSW 7 87,685,382 (GRCm39) missense probably benign 0.16
R7967:Grm5 UTSW 7 87,624,569 (GRCm39) missense probably damaging 0.99
R8260:Grm5 UTSW 7 87,724,340 (GRCm39) critical splice donor site probably null
R8345:Grm5 UTSW 7 87,723,746 (GRCm39) missense probably damaging 1.00
R8460:Grm5 UTSW 7 87,252,249 (GRCm39) missense probably damaging 1.00
R8473:Grm5 UTSW 7 87,252,278 (GRCm39) missense probably damaging 0.97
R8531:Grm5 UTSW 7 87,779,724 (GRCm39) missense probably benign 0.05
R8671:Grm5 UTSW 7 87,765,498 (GRCm39) critical splice donor site probably null
R9036:Grm5 UTSW 7 87,685,397 (GRCm39) missense possibly damaging 0.94
R9106:Grm5 UTSW 7 87,723,747 (GRCm39) missense probably damaging 1.00
R9136:Grm5 UTSW 7 87,689,254 (GRCm39) missense possibly damaging 0.95
R9189:Grm5 UTSW 7 87,724,024 (GRCm39) missense probably damaging 1.00
R9196:Grm5 UTSW 7 87,723,518 (GRCm39) missense probably damaging 1.00
R9232:Grm5 UTSW 7 87,723,591 (GRCm39) missense probably damaging 1.00
R9234:Grm5 UTSW 7 87,723,440 (GRCm39) missense probably damaging 1.00
R9384:Grm5 UTSW 7 87,723,518 (GRCm39) missense probably damaging 1.00
R9424:Grm5 UTSW 7 87,765,484 (GRCm39) missense probably benign 0.00
R9531:Grm5 UTSW 7 87,780,075 (GRCm39) makesense probably null
R9631:Grm5 UTSW 7 87,624,560 (GRCm39) missense probably damaging 0.98
R9691:Grm5 UTSW 7 87,723,903 (GRCm39) missense probably damaging 1.00
Z1176:Grm5 UTSW 7 87,251,923 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTGTTCATCTTCATACAGGCAAC -3'
(R):5'- ATCTGCACATACTGTAGCTATTCAC -3'

Sequencing Primer
(F):5'- GCAACTATGGAGAAAGTGGGATG -3'
(R):5'- GTGATAGTTACACTCTCCTGATACAC -3'
Posted On 2021-04-30