Incidental Mutation 'R8805:Cfap46'
ID 672003
Institutional Source Beutler Lab
Gene Symbol Cfap46
Ensembl Gene ENSMUSG00000049571
Gene Name cilia and flagella associated protein 46
Synonyms 9330101J02Rik, Ttc40
MMRRC Submission 068642-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8805 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 139180867-139263733 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 139211979 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Threonine at position 1669 (A1669T)
Ref Sequence ENSEMBL: ENSMUSP00000120186 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000129990]
AlphaFold E9Q2C0
Predicted Effect unknown
Transcript: ENSMUST00000129990
AA Change: A1669T
SMART Domains Protein: ENSMUSP00000120186
Gene: ENSMUSG00000049571
AA Change: A1669T

DomainStartEndE-ValueType
Blast:TPR 175 207 7e-11 BLAST
Blast:TPR 426 459 1e-11 BLAST
low complexity region 868 879 N/A INTRINSIC
Blast:TPR 936 969 2e-7 BLAST
Blast:TPR 1112 1145 1e-9 BLAST
coiled coil region 1347 1423 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 96% (70/73)
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik G A 17: 9,226,737 (GRCm39) W467* probably null Het
4921509C19Rik A T 2: 151,313,285 (GRCm39) probably benign Het
Actl6b G A 5: 137,552,918 (GRCm39) M82I probably benign Het
Bmp2 T A 2: 133,403,254 (GRCm39) D268E probably damaging Het
Cacng7 T A 7: 3,415,298 (GRCm39) L221H probably damaging Het
Ccser2 A G 14: 36,601,712 (GRCm39) V224A probably damaging Het
Cdc40 A G 10: 40,733,576 (GRCm39) F125L probably damaging Het
Cfap58 A T 19: 47,941,535 (GRCm39) E301V probably damaging Het
Clcn2 C A 16: 20,532,168 (GRCm39) G96C probably damaging Het
Cotl1 T A 8: 120,536,944 (GRCm39) probably benign Het
Cps1 G A 1: 67,216,110 (GRCm39) A812T probably damaging Het
Cracd T C 5: 77,006,489 (GRCm39) V950A unknown Het
Crnkl1 T C 2: 145,773,350 (GRCm39) probably null Het
Cry1 A G 10: 84,992,969 (GRCm39) V83A probably benign Het
Cyp2a5 G T 7: 26,540,530 (GRCm39) R381L probably damaging Het
Cyp46a1 T C 12: 108,327,462 (GRCm39) F425L probably damaging Het
Dek A T 13: 47,252,930 (GRCm39) N158K unknown Het
Dgcr8 T A 16: 18,076,161 (GRCm39) Q674L probably damaging Het
Dlec1 C A 9: 118,941,650 (GRCm39) S345R probably benign Het
Dnah7b T A 1: 46,273,305 (GRCm39) C2478S possibly damaging Het
Dstyk T A 1: 132,361,963 (GRCm39) L131Q probably damaging Het
Fbxw7 T A 3: 84,862,227 (GRCm39) L186M Het
Fn1 T C 1: 71,644,239 (GRCm39) Q1684R probably benign Het
Fsip2 C A 2: 82,813,453 (GRCm39) H3257Q possibly damaging Het
Gm5773 T C 3: 93,681,042 (GRCm39) V238A probably damaging Het
Gm9611 T C 14: 42,116,657 (GRCm39) D131G Het
Gpatch8 T C 11: 102,371,018 (GRCm39) E840G unknown Het
Grm5 G A 7: 87,453,176 (GRCm39) R271Q probably damaging Het
Has3 A T 8: 107,601,135 (GRCm39) Y199F probably damaging Het
Hmcn2 A G 2: 31,315,393 (GRCm39) N3714S probably benign Het
Idh1 CA CAA 1: 65,204,347 (GRCm39) probably null Het
Il2 T A 3: 37,177,282 (GRCm39) T85S possibly damaging Het
Kank4 T C 4: 98,668,273 (GRCm39) H58R possibly damaging Het
Kcnk4 T A 19: 6,905,379 (GRCm39) I154F probably damaging Het
Krt1c T C 15: 101,724,379 (GRCm39) K295R possibly damaging Het
Lipm A T 19: 34,090,308 (GRCm39) D163V probably damaging Het
Lpl A G 8: 69,340,215 (GRCm39) N70S probably damaging Het
Mgme1 A G 2: 144,114,451 (GRCm39) probably benign Het
Mnd1 T A 3: 83,995,432 (GRCm39) E187D probably benign Het
Morn5 A G 2: 35,969,533 (GRCm39) D149G probably benign Het
Mrrf G A 2: 36,037,965 (GRCm39) V79I probably damaging Het
Msh4 T A 3: 153,563,270 (GRCm39) Q896L probably benign Het
Mtus2 A C 5: 148,015,303 (GRCm39) M699L possibly damaging Het
Mycbp T A 4: 123,803,880 (GRCm39) C130S unknown Het
Ntn5 A T 7: 45,333,899 (GRCm39) Y4F probably benign Het
Or7e174 T C 9: 20,012,580 (GRCm39) V175A probably benign Het
Osm A G 11: 4,189,839 (GRCm39) S208G probably benign Het
Pcsk6 T A 7: 65,578,891 (GRCm39) Y222N possibly damaging Het
Pde6a A G 18: 61,390,104 (GRCm39) E486G probably benign Het
Pdzk1 T A 3: 96,758,910 (GRCm39) L105Q possibly damaging Het
Prkd1 C G 12: 50,435,155 (GRCm39) S524T probably benign Het
Prkd1 T A 12: 50,435,156 (GRCm39) S524C probably damaging Het
Rab4b T C 7: 26,874,148 (GRCm39) I90V Het
Rc3h1 T C 1: 160,795,222 (GRCm39) V1083A probably benign Het
Rfx7 C T 9: 72,524,316 (GRCm39) T502I probably benign Het
Rtn4rl2 T C 2: 84,702,558 (GRCm39) Y332C probably damaging Het
Senp2 A G 16: 21,846,789 (GRCm39) T265A probably benign Het
Slc38a3 T C 9: 107,532,345 (GRCm39) M396V probably benign Het
Sord G A 2: 122,094,607 (GRCm39) V332I probably benign Het
Sprr1b GTGGCAGGGCTCAGGAGCCTTGGGGTGGCAGGGCTCAGGAGCCTTGGGATGGCAGGGCTCAGGAGCCTTGGGGTGGCAGGGCTCAGGA GTGGCAGGGCTCAGGAGCCTTGGGGTGGCAGGGCTCAGGA 3: 92,344,653 (GRCm39) probably benign Het
Star G A 8: 26,299,577 (GRCm39) R53H probably benign Het
Stard4 T G 18: 33,336,749 (GRCm39) I189L possibly damaging Het
Stk38 G T 17: 29,219,094 (GRCm39) T7K probably benign Het
Stxbp5 T A 10: 9,713,859 (GRCm39) K227* probably null Het
Taf4b C T 18: 14,946,485 (GRCm39) P436L possibly damaging Het
Tgm3 T A 2: 129,889,702 (GRCm39) V632E probably damaging Het
Tmem158 A G 9: 123,089,309 (GRCm39) F101S probably damaging Het
Trmt10b T C 4: 45,301,281 (GRCm39) S77P probably benign Het
Ttn A T 2: 76,720,307 (GRCm39) L6973* probably null Het
Tubal3 T C 13: 3,983,293 (GRCm39) F358L probably damaging Het
Tut4 T C 4: 108,406,575 (GRCm39) V1381A possibly damaging Het
Vmn1r214 C T 13: 23,219,273 (GRCm39) L256F possibly damaging Het
Vmn2r86 A G 10: 130,282,396 (GRCm39) V740A probably benign Het
Yipf1 A T 4: 107,193,355 (GRCm39) E80D probably benign Het
Zdhhc2 G T 8: 40,898,846 (GRCm39) probably null Het
Zfp655 C T 5: 145,181,290 (GRCm39) H383Y probably damaging Het
Zfp981 C T 4: 146,622,410 (GRCm39) T445I possibly damaging Het
Other mutations in Cfap46
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00480:Cfap46 APN 7 139,240,605 (GRCm39) missense probably damaging 0.96
IGL00493:Cfap46 APN 7 139,194,359 (GRCm39) missense probably benign 0.06
IGL00505:Cfap46 APN 7 139,240,605 (GRCm39) missense probably damaging 0.96
IGL00508:Cfap46 APN 7 139,240,605 (GRCm39) missense probably damaging 0.96
IGL00514:Cfap46 APN 7 139,240,605 (GRCm39) missense probably damaging 0.96
IGL01394:Cfap46 APN 7 139,246,895 (GRCm39) missense probably damaging 1.00
IGL01621:Cfap46 APN 7 139,186,523 (GRCm39) missense unknown
IGL02171:Cfap46 APN 7 139,246,972 (GRCm39) missense possibly damaging 0.86
IGL02343:Cfap46 APN 7 139,262,425 (GRCm39) missense probably damaging 0.99
IGL02679:Cfap46 APN 7 139,194,386 (GRCm39) missense probably damaging 0.99
IGL02687:Cfap46 APN 7 139,187,117 (GRCm39) missense probably damaging 0.99
IGL03180:Cfap46 APN 7 139,183,168 (GRCm39) missense unknown
IGL03329:Cfap46 APN 7 139,181,081 (GRCm39) missense probably damaging 0.99
FR4449:Cfap46 UTSW 7 139,218,711 (GRCm39) utr 3 prime probably benign
FR4737:Cfap46 UTSW 7 139,218,846 (GRCm39) utr 3 prime probably benign
FR4976:Cfap46 UTSW 7 139,218,846 (GRCm39) utr 3 prime probably benign
PIT4651001:Cfap46 UTSW 7 139,225,467 (GRCm39) missense
R0051:Cfap46 UTSW 7 139,255,951 (GRCm39) missense probably damaging 1.00
R0051:Cfap46 UTSW 7 139,255,951 (GRCm39) missense probably damaging 1.00
R0318:Cfap46 UTSW 7 139,234,482 (GRCm39) missense probably damaging 1.00
R0358:Cfap46 UTSW 7 139,231,449 (GRCm39) splice site probably benign
R0650:Cfap46 UTSW 7 139,185,571 (GRCm39) missense unknown
R0675:Cfap46 UTSW 7 139,255,950 (GRCm39) missense probably damaging 1.00
R0750:Cfap46 UTSW 7 139,234,586 (GRCm39) missense probably damaging 1.00
R0931:Cfap46 UTSW 7 139,235,757 (GRCm39) missense probably damaging 1.00
R1024:Cfap46 UTSW 7 139,222,513 (GRCm39) missense probably benign 0.42
R1251:Cfap46 UTSW 7 139,181,181 (GRCm39) missense probably benign 0.40
R1257:Cfap46 UTSW 7 139,234,545 (GRCm39) nonsense probably null
R1538:Cfap46 UTSW 7 139,262,924 (GRCm39) missense probably null 1.00
R1618:Cfap46 UTSW 7 139,232,726 (GRCm39) missense probably benign 0.04
R1655:Cfap46 UTSW 7 139,222,436 (GRCm39) nonsense probably null
R1824:Cfap46 UTSW 7 139,219,518 (GRCm39) missense probably benign 0.12
R1830:Cfap46 UTSW 7 139,220,323 (GRCm39) missense possibly damaging 0.92
R1857:Cfap46 UTSW 7 139,233,324 (GRCm39) missense probably damaging 1.00
R1870:Cfap46 UTSW 7 139,263,386 (GRCm39) missense probably damaging 1.00
R1945:Cfap46 UTSW 7 139,259,819 (GRCm39) missense probably damaging 1.00
R1962:Cfap46 UTSW 7 139,246,957 (GRCm39) missense probably damaging 1.00
R2108:Cfap46 UTSW 7 139,263,677 (GRCm39) missense probably benign 0.03
R2354:Cfap46 UTSW 7 139,240,962 (GRCm39) missense probably damaging 0.99
R2367:Cfap46 UTSW 7 139,233,414 (GRCm39) missense probably damaging 0.99
R3237:Cfap46 UTSW 7 139,197,506 (GRCm39) missense probably damaging 1.00
R3617:Cfap46 UTSW 7 139,219,515 (GRCm39) missense probably benign 0.06
R3949:Cfap46 UTSW 7 139,258,467 (GRCm39) missense probably benign 0.12
R4239:Cfap46 UTSW 7 139,246,203 (GRCm39) missense possibly damaging 0.74
R4240:Cfap46 UTSW 7 139,246,203 (GRCm39) missense possibly damaging 0.74
R4297:Cfap46 UTSW 7 139,232,589 (GRCm39) missense probably benign 0.27
R4365:Cfap46 UTSW 7 139,230,868 (GRCm39) missense probably damaging 0.99
R4516:Cfap46 UTSW 7 139,239,998 (GRCm39) intron probably benign
R4595:Cfap46 UTSW 7 139,232,320 (GRCm39) missense possibly damaging 0.74
R4627:Cfap46 UTSW 7 139,260,843 (GRCm39) missense probably damaging 1.00
R4627:Cfap46 UTSW 7 139,237,197 (GRCm39) missense probably damaging 0.99
R4628:Cfap46 UTSW 7 139,260,843 (GRCm39) missense probably damaging 1.00
R4629:Cfap46 UTSW 7 139,260,843 (GRCm39) missense probably damaging 1.00
R4687:Cfap46 UTSW 7 139,207,372 (GRCm39) missense possibly damaging 0.79
R4750:Cfap46 UTSW 7 139,259,239 (GRCm39) critical splice donor site probably null
R4771:Cfap46 UTSW 7 139,210,524 (GRCm39) missense probably null
R4779:Cfap46 UTSW 7 139,239,731 (GRCm39) intron probably benign
R4812:Cfap46 UTSW 7 139,215,916 (GRCm39) missense probably damaging 1.00
R4974:Cfap46 UTSW 7 139,187,104 (GRCm39) critical splice donor site probably null
R5014:Cfap46 UTSW 7 139,207,291 (GRCm39) missense probably benign 0.12
R5033:Cfap46 UTSW 7 139,183,776 (GRCm39) missense probably benign 0.00
R5055:Cfap46 UTSW 7 139,241,106 (GRCm39) missense probably damaging 1.00
R5254:Cfap46 UTSW 7 139,258,430 (GRCm39) missense possibly damaging 0.77
R5288:Cfap46 UTSW 7 139,193,423 (GRCm39) critical splice donor site probably null
R5366:Cfap46 UTSW 7 139,230,802 (GRCm39) missense probably damaging 1.00
R5368:Cfap46 UTSW 7 139,207,389 (GRCm39) missense possibly damaging 0.77
R5371:Cfap46 UTSW 7 139,212,097 (GRCm39) splice site probably null
R5642:Cfap46 UTSW 7 139,258,493 (GRCm39) missense probably damaging 1.00
R5690:Cfap46 UTSW 7 139,218,269 (GRCm39) missense probably benign 0.01
R5691:Cfap46 UTSW 7 139,186,616 (GRCm39) missense possibly damaging 0.49
R5696:Cfap46 UTSW 7 139,191,947 (GRCm39) missense probably damaging 1.00
R5844:Cfap46 UTSW 7 139,230,858 (GRCm39) missense probably damaging 0.99
R5963:Cfap46 UTSW 7 139,231,511 (GRCm39) missense probably damaging 0.97
R6217:Cfap46 UTSW 7 139,218,816 (GRCm39) utr 3 prime probably benign
R6228:Cfap46 UTSW 7 139,236,496 (GRCm39) missense probably damaging 1.00
R6251:Cfap46 UTSW 7 139,218,816 (GRCm39) utr 3 prime probably benign
R6253:Cfap46 UTSW 7 139,218,816 (GRCm39) utr 3 prime probably benign
R6285:Cfap46 UTSW 7 139,241,001 (GRCm39) missense probably damaging 1.00
R6334:Cfap46 UTSW 7 139,260,747 (GRCm39) missense probably damaging 1.00
R6520:Cfap46 UTSW 7 139,194,321 (GRCm39) critical splice donor site probably null
R6736:Cfap46 UTSW 7 139,199,887 (GRCm39) missense possibly damaging 0.92
R6760:Cfap46 UTSW 7 139,232,356 (GRCm39) missense probably damaging 1.00
R6773:Cfap46 UTSW 7 139,222,477 (GRCm39) utr 3 prime probably benign
R6835:Cfap46 UTSW 7 139,232,414 (GRCm39) missense probably damaging 0.98
R6903:Cfap46 UTSW 7 139,234,477 (GRCm39) critical splice donor site probably null
R6912:Cfap46 UTSW 7 139,219,616 (GRCm39) missense probably benign 0.09
R7163:Cfap46 UTSW 7 139,197,994 (GRCm39) critical splice donor site probably null
R7232:Cfap46 UTSW 7 139,197,493 (GRCm39) missense unknown
R7327:Cfap46 UTSW 7 139,215,062 (GRCm39) splice site probably null
R7336:Cfap46 UTSW 7 139,200,020 (GRCm39) missense unknown
R7337:Cfap46 UTSW 7 139,210,492 (GRCm39) critical splice donor site probably null
R7437:Cfap46 UTSW 7 139,230,753 (GRCm39) nonsense probably null
R7450:Cfap46 UTSW 7 139,197,353 (GRCm39) missense unknown
R7495:Cfap46 UTSW 7 139,183,112 (GRCm39) critical splice donor site probably null
R7618:Cfap46 UTSW 7 139,183,155 (GRCm39) missense
R7623:Cfap46 UTSW 7 139,198,266 (GRCm39) missense unknown
R7765:Cfap46 UTSW 7 139,231,480 (GRCm39) missense
R7971:Cfap46 UTSW 7 139,215,043 (GRCm39) missense unknown
R8211:Cfap46 UTSW 7 139,213,220 (GRCm39) missense unknown
R8306:Cfap46 UTSW 7 139,236,496 (GRCm39) missense
R8354:Cfap46 UTSW 7 139,233,414 (GRCm39) missense probably benign 0.03
R8365:Cfap46 UTSW 7 139,263,000 (GRCm39) nonsense probably null
R8447:Cfap46 UTSW 7 139,260,902 (GRCm39) missense possibly damaging 0.90
R8715:Cfap46 UTSW 7 139,185,560 (GRCm39) missense
R8830:Cfap46 UTSW 7 139,195,565 (GRCm39) missense unknown
R8912:Cfap46 UTSW 7 139,260,097 (GRCm39) intron probably benign
R8920:Cfap46 UTSW 7 139,232,442 (GRCm39) missense
R8977:Cfap46 UTSW 7 139,259,849 (GRCm39) missense probably benign 0.01
R9048:Cfap46 UTSW 7 139,207,259 (GRCm39) missense unknown
R9224:Cfap46 UTSW 7 139,258,416 (GRCm39) nonsense probably null
R9243:Cfap46 UTSW 7 139,195,265 (GRCm39) intron probably benign
R9252:Cfap46 UTSW 7 139,198,165 (GRCm39) missense unknown
R9276:Cfap46 UTSW 7 139,201,207 (GRCm39) missense unknown
R9301:Cfap46 UTSW 7 139,222,461 (GRCm39) missense
R9391:Cfap46 UTSW 7 139,198,027 (GRCm39) missense unknown
R9402:Cfap46 UTSW 7 139,215,865 (GRCm39) missense unknown
R9443:Cfap46 UTSW 7 139,195,023 (GRCm39) missense
R9564:Cfap46 UTSW 7 139,231,471 (GRCm39) missense
R9625:Cfap46 UTSW 7 139,230,805 (GRCm39) missense
R9626:Cfap46 UTSW 7 139,230,805 (GRCm39) missense
R9638:Cfap46 UTSW 7 139,209,763 (GRCm39) missense unknown
R9656:Cfap46 UTSW 7 139,235,816 (GRCm39) missense
R9658:Cfap46 UTSW 7 139,246,229 (GRCm39) missense
R9747:Cfap46 UTSW 7 139,191,907 (GRCm39) missense unknown
RF023:Cfap46 UTSW 7 139,218,834 (GRCm39)
W0251:Cfap46 UTSW 7 139,183,862 (GRCm39) missense probably benign 0.11
X0018:Cfap46 UTSW 7 139,260,828 (GRCm39) missense probably benign 0.03
X0064:Cfap46 UTSW 7 139,183,363 (GRCm39) missense probably benign 0.01
Z1088:Cfap46 UTSW 7 139,214,980 (GRCm39) missense probably damaging 0.96
Z1176:Cfap46 UTSW 7 139,219,464 (GRCm39) missense
Z1177:Cfap46 UTSW 7 139,210,542 (GRCm39) missense unknown
Z1177:Cfap46 UTSW 7 139,181,183 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- ACTCGTCTTTTAGGGGAACTCAG -3'
(R):5'- TCATAAGTTAGACAGTCAGGGGC -3'

Sequencing Primer
(F):5'- CTTTTAGGGGAACTCAGTGGAGACC -3'
(R):5'- ACATCCCTGTGGCCATGAG -3'
Posted On 2021-04-30