Incidental Mutation 'R8805:Cfap46'
ID672003
Institutional Source Beutler Lab
Gene Symbol Cfap46
Ensembl Gene ENSMUSG00000049571
Gene Namecilia and flagella associated protein 46
Synonyms9330101J02Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8805 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location139600951-139683817 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 139632063 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 1669 (A1669T)
Ref Sequence ENSEMBL: ENSMUSP00000120186 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000129990]
Predicted Effect unknown
Transcript: ENSMUST00000129990
AA Change: A1669T
SMART Domains Protein: ENSMUSP00000120186
Gene: ENSMUSG00000049571
AA Change: A1669T

DomainStartEndE-ValueType
Blast:TPR 175 207 7e-11 BLAST
Blast:TPR 426 459 1e-11 BLAST
low complexity region 868 879 N/A INTRINSIC
Blast:TPR 936 969 2e-7 BLAST
Blast:TPR 1112 1145 1e-9 BLAST
coiled coil region 1347 1423 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik G A 17: 9,007,905 W467* probably null Het
Actl6b G A 5: 137,554,656 M82I probably benign Het
Bmp2 T A 2: 133,561,334 D268E probably damaging Het
C530008M17Rik T C 5: 76,858,642 V950A unknown Het
Cacng7 T A 7: 3,366,782 L221H probably damaging Het
Ccser2 A G 14: 36,879,755 V224A probably damaging Het
Cdc40 A G 10: 40,857,580 F125L probably damaging Het
Cfap58 A T 19: 47,953,096 E301V probably damaging Het
Clcn2 C A 16: 20,713,418 G96C probably damaging Het
Cps1 G A 1: 67,176,951 A812T probably damaging Het
Crnkl1 T C 2: 145,931,430 probably null Het
Cry1 A G 10: 85,157,105 V83A probably benign Het
Cyp2a5 G T 7: 26,841,105 R381L probably damaging Het
Cyp46a1 T C 12: 108,361,203 F425L probably damaging Het
Dek A T 13: 47,099,454 N158K unknown Het
Dgcr8 T A 16: 18,258,297 Q674L probably damaging Het
Dlec1 C A 9: 119,112,582 S345R probably benign Het
Dnah7b T A 1: 46,234,145 C2478S possibly damaging Het
Dnah8 CGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTT CGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTT 17: 30,760,867 probably null Het
Dstyk T A 1: 132,434,225 L131Q probably damaging Het
Fbxw7 T A 3: 84,954,920 L186M Het
Fn1 T C 1: 71,605,080 Q1684R probably benign Het
Fsip2 C A 2: 82,983,109 H3257Q possibly damaging Het
Gm5773 T C 3: 93,773,735 V238A probably damaging Het
Gm9611 T C 14: 42,294,700 D131G Het
Gpatch8 T C 11: 102,480,192 E840G unknown Het
Grm5 G A 7: 87,803,968 R271Q probably damaging Het
Has3 A T 8: 106,874,503 Y199F probably damaging Het
Hmcn2 A G 2: 31,425,381 N3714S probably benign Het
Idh1 CA CAA 1: 65,165,188 probably null Het
Il2 T A 3: 37,123,133 T85S possibly damaging Het
Kank4 T C 4: 98,780,036 H58R possibly damaging Het
Kcnk4 T A 19: 6,928,011 I154F probably damaging Het
Krt2 T C 15: 101,815,944 K295R possibly damaging Het
Lipm A T 19: 34,112,908 D163V probably damaging Het
Lpl A G 8: 68,887,563 N70S probably damaging Het
Mnd1 T A 3: 84,088,125 E187D probably benign Het
Morn5 A G 2: 36,079,521 D149G probably benign Het
Mrrf G A 2: 36,147,953 V79I probably damaging Het
Msh4 T A 3: 153,857,633 Q896L probably benign Het
Mtus2 A C 5: 148,078,493 M699L possibly damaging Het
Mycbp T A 4: 123,910,087 C130S unknown Het
Ntn5 A T 7: 45,684,475 Y4F probably benign Het
Olfr868 T C 9: 20,101,284 V175A probably benign Het
Osm A G 11: 4,239,839 S208G probably benign Het
Pcsk6 T A 7: 65,929,143 Y222N possibly damaging Het
Pde6a A G 18: 61,257,033 E486G probably benign Het
Pdzk1 T A 3: 96,851,594 L105Q possibly damaging Het
Prkd1 C G 12: 50,388,372 S524T probably benign Het
Prkd1 T A 12: 50,388,373 S524C probably damaging Het
Rab4b T C 7: 27,174,723 I90V Het
Rc3h1 T C 1: 160,967,652 V1083A probably benign Het
Rfx7 C T 9: 72,617,034 T502I probably benign Het
Rtn4rl2 T C 2: 84,872,214 Y332C probably damaging Het
Senp2 A G 16: 22,028,039 T265A probably benign Het
Slc38a3 T C 9: 107,655,146 M396V probably benign Het
Sord G A 2: 122,264,126 V332I probably benign Het
Sprr1b GTGGCAGGGCTCAGGAGCCTTGGGGTGGCAGGGCTCAGGAGCCTTGGGATGGCAGGGCTCAGGAGCCTTGGGGTGGCAGGGCTCAGGA GTGGCAGGGCTCAGGAGCCTTGGGGTGGCAGGGCTCAGGA 3: 92,437,346 probably benign Het
Star G A 8: 25,809,549 R53H probably benign Het
Stard4 T G 18: 33,203,696 I189L possibly damaging Het
Stk38 G T 17: 29,000,120 T7K probably benign Het
Stxbp5 T A 10: 9,838,115 K227* probably null Het
Taf4b C T 18: 14,813,428 P436L possibly damaging Het
Tgm3 T A 2: 130,047,782 V632E probably damaging Het
Tmem158 A G 9: 123,260,244 F101S probably damaging Het
Trmt10b T C 4: 45,301,281 S77P probably benign Het
Ttn A T 2: 76,889,963 L6973* probably null Het
Tubal3 T C 13: 3,933,293 F358L probably damaging Het
Vmn1r214 C T 13: 23,035,103 L256F possibly damaging Het
Vmn2r86 A G 10: 130,446,527 V740A probably benign Het
Yipf1 A T 4: 107,336,158 E80D probably benign Het
Zcchc11 T C 4: 108,549,378 V1381A possibly damaging Het
Zdhhc2 G T 8: 40,445,805 probably null Het
Zfp655 C T 5: 145,244,480 H383Y probably damaging Het
Other mutations in Cfap46
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00480:Cfap46 APN 7 139660689 missense probably damaging 0.96
IGL00493:Cfap46 APN 7 139614443 missense probably benign 0.06
IGL00505:Cfap46 APN 7 139660689 missense probably damaging 0.96
IGL00508:Cfap46 APN 7 139660689 missense probably damaging 0.96
IGL00514:Cfap46 APN 7 139660689 missense probably damaging 0.96
IGL01394:Cfap46 APN 7 139666979 missense probably damaging 1.00
IGL01621:Cfap46 APN 7 139606607 missense unknown
IGL02171:Cfap46 APN 7 139667056 missense possibly damaging 0.86
IGL02343:Cfap46 APN 7 139682509 missense probably damaging 0.99
IGL02679:Cfap46 APN 7 139614470 missense probably damaging 0.99
IGL02687:Cfap46 APN 7 139607201 missense probably damaging 0.99
IGL03180:Cfap46 APN 7 139603252 missense unknown
IGL03329:Cfap46 APN 7 139601165 missense probably damaging 0.99
FR4449:Cfap46 UTSW 7 139638795 utr 3 prime probably benign
FR4737:Cfap46 UTSW 7 139638930 utr 3 prime probably benign
FR4976:Cfap46 UTSW 7 139638930 utr 3 prime probably benign
PIT4651001:Cfap46 UTSW 7 139645551 missense
R0051:Cfap46 UTSW 7 139676035 missense probably damaging 1.00
R0051:Cfap46 UTSW 7 139676035 missense probably damaging 1.00
R0318:Cfap46 UTSW 7 139654566 missense probably damaging 1.00
R0358:Cfap46 UTSW 7 139651533 splice site probably benign
R0650:Cfap46 UTSW 7 139605655 missense unknown
R0675:Cfap46 UTSW 7 139676034 missense probably damaging 1.00
R0750:Cfap46 UTSW 7 139654670 missense probably damaging 1.00
R0931:Cfap46 UTSW 7 139655841 missense probably damaging 1.00
R1024:Cfap46 UTSW 7 139642597 missense probably benign 0.42
R1251:Cfap46 UTSW 7 139601265 missense probably benign 0.40
R1257:Cfap46 UTSW 7 139654629 nonsense probably null
R1538:Cfap46 UTSW 7 139683008 missense probably null 1.00
R1618:Cfap46 UTSW 7 139652810 missense probably benign 0.04
R1655:Cfap46 UTSW 7 139642520 nonsense probably null
R1824:Cfap46 UTSW 7 139639602 missense probably benign 0.12
R1830:Cfap46 UTSW 7 139640407 missense possibly damaging 0.92
R1857:Cfap46 UTSW 7 139653408 missense probably damaging 1.00
R1870:Cfap46 UTSW 7 139683470 missense probably damaging 1.00
R1945:Cfap46 UTSW 7 139679903 missense probably damaging 1.00
R1962:Cfap46 UTSW 7 139667041 missense probably damaging 1.00
R2108:Cfap46 UTSW 7 139683761 missense probably benign 0.03
R2354:Cfap46 UTSW 7 139661046 missense probably damaging 0.99
R2367:Cfap46 UTSW 7 139653498 missense probably damaging 0.99
R3237:Cfap46 UTSW 7 139617590 missense probably damaging 1.00
R3617:Cfap46 UTSW 7 139639599 missense probably benign 0.06
R3949:Cfap46 UTSW 7 139678551 missense probably benign 0.12
R4239:Cfap46 UTSW 7 139666287 missense possibly damaging 0.74
R4240:Cfap46 UTSW 7 139666287 missense possibly damaging 0.74
R4297:Cfap46 UTSW 7 139652673 missense probably benign 0.27
R4365:Cfap46 UTSW 7 139650952 missense probably damaging 0.99
R4516:Cfap46 UTSW 7 139660082 intron probably benign
R4595:Cfap46 UTSW 7 139652404 missense possibly damaging 0.74
R4627:Cfap46 UTSW 7 139657281 missense probably damaging 0.99
R4627:Cfap46 UTSW 7 139680927 missense probably damaging 1.00
R4628:Cfap46 UTSW 7 139680927 missense probably damaging 1.00
R4629:Cfap46 UTSW 7 139680927 missense probably damaging 1.00
R4687:Cfap46 UTSW 7 139627456 missense possibly damaging 0.79
R4750:Cfap46 UTSW 7 139679323 critical splice donor site probably null
R4771:Cfap46 UTSW 7 139630608 missense probably null
R4779:Cfap46 UTSW 7 139659815 intron probably benign
R4812:Cfap46 UTSW 7 139636000 missense probably damaging 1.00
R4974:Cfap46 UTSW 7 139607188 critical splice donor site probably null
R5014:Cfap46 UTSW 7 139627375 missense probably benign 0.12
R5033:Cfap46 UTSW 7 139603860 missense probably benign 0.00
R5055:Cfap46 UTSW 7 139661190 missense probably damaging 1.00
R5254:Cfap46 UTSW 7 139678514 missense possibly damaging 0.77
R5288:Cfap46 UTSW 7 139613507 critical splice donor site probably null
R5366:Cfap46 UTSW 7 139650886 missense probably damaging 1.00
R5368:Cfap46 UTSW 7 139627473 missense possibly damaging 0.77
R5371:Cfap46 UTSW 7 139632181 splice site probably null
R5642:Cfap46 UTSW 7 139678577 missense probably damaging 1.00
R5690:Cfap46 UTSW 7 139638353 missense probably benign 0.01
R5691:Cfap46 UTSW 7 139606700 missense possibly damaging 0.49
R5696:Cfap46 UTSW 7 139612031 missense probably damaging 1.00
R5844:Cfap46 UTSW 7 139650942 missense probably damaging 0.99
R5963:Cfap46 UTSW 7 139651595 missense probably damaging 0.97
R6217:Cfap46 UTSW 7 139638900 utr 3 prime probably benign
R6228:Cfap46 UTSW 7 139656580 missense probably damaging 1.00
R6251:Cfap46 UTSW 7 139638900 utr 3 prime probably benign
R6253:Cfap46 UTSW 7 139638900 utr 3 prime probably benign
R6285:Cfap46 UTSW 7 139661085 missense probably damaging 1.00
R6334:Cfap46 UTSW 7 139680831 missense probably damaging 1.00
R6520:Cfap46 UTSW 7 139614405 critical splice donor site probably null
R6736:Cfap46 UTSW 7 139619971 missense possibly damaging 0.92
R6760:Cfap46 UTSW 7 139652440 missense probably damaging 1.00
R6773:Cfap46 UTSW 7 139642561 utr 3 prime probably benign
R6835:Cfap46 UTSW 7 139652498 missense probably damaging 0.98
R6903:Cfap46 UTSW 7 139654561 critical splice donor site probably null
R6912:Cfap46 UTSW 7 139639700 missense probably benign 0.09
R7163:Cfap46 UTSW 7 139618078 critical splice donor site probably null
R7232:Cfap46 UTSW 7 139617577 missense unknown
R7327:Cfap46 UTSW 7 139635146 splice site probably null
R7336:Cfap46 UTSW 7 139620104 missense unknown
R7337:Cfap46 UTSW 7 139630576 critical splice donor site probably null
R7437:Cfap46 UTSW 7 139650837 nonsense probably null
R7450:Cfap46 UTSW 7 139617437 missense unknown
R7495:Cfap46 UTSW 7 139603196 critical splice donor site probably null
R7618:Cfap46 UTSW 7 139603239 missense
R7623:Cfap46 UTSW 7 139618350 missense unknown
R7765:Cfap46 UTSW 7 139651564 missense
R7971:Cfap46 UTSW 7 139635127 missense unknown
R8211:Cfap46 UTSW 7 139633304 missense unknown
R8306:Cfap46 UTSW 7 139656580 missense
R8354:Cfap46 UTSW 7 139653498 missense probably benign 0.03
R8365:Cfap46 UTSW 7 139683084 nonsense probably null
R8447:Cfap46 UTSW 7 139680986 missense possibly damaging 0.90
R8715:Cfap46 UTSW 7 139605644 missense
R8830:Cfap46 UTSW 7 139615649 missense unknown
R8920:Cfap46 UTSW 7 139652526 missense
RF023:Cfap46 UTSW 7 139638918
W0251:Cfap46 UTSW 7 139603946 missense probably benign 0.11
X0018:Cfap46 UTSW 7 139680912 missense probably benign 0.03
X0064:Cfap46 UTSW 7 139603447 missense probably benign 0.01
Z1088:Cfap46 UTSW 7 139635064 missense probably damaging 0.96
Z1176:Cfap46 UTSW 7 139639548 missense
Z1177:Cfap46 UTSW 7 139601267 missense unknown
Z1177:Cfap46 UTSW 7 139630626 missense unknown
Predicted Primers PCR Primer
(F):5'- ACTCGTCTTTTAGGGGAACTCAG -3'
(R):5'- TCATAAGTTAGACAGTCAGGGGC -3'

Sequencing Primer
(F):5'- CTTTTAGGGGAACTCAGTGGAGACC -3'
(R):5'- ACATCCCTGTGGCCATGAG -3'
Posted On2021-04-30