Incidental Mutation 'R8805:Prkd1'
ID 672020
Institutional Source Beutler Lab
Gene Symbol Prkd1
Ensembl Gene ENSMUSG00000002688
Gene Name protein kinase D1
Synonyms PKD1, Prkcm, Pkcm
MMRRC Submission 068642-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8805 (G1)
Quality Score 225.009
Status Not validated
Chromosome 12
Chromosomal Location 50388014-50695881 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 50435156 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Cysteine at position 524 (S524C)
Ref Sequence ENSEMBL: ENSMUSP00000002765 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002765]
AlphaFold Q62101
Predicted Effect probably damaging
Transcript: ENSMUST00000002765
AA Change: S524C

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000002765
Gene: ENSMUSG00000002688
AA Change: S524C

DomainStartEndE-ValueType
low complexity region 2 46 N/A INTRINSIC
C1 138 194 1.36e-12 SMART
C1 277 326 5.95e-18 SMART
PH 429 549 5.33e-9 SMART
S_TKc 589 845 1.24e-92 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 96% (70/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a serine/threonine protein kinase involved in many cellular processes, including Golgi body membrane integrity and transport, cell migration and differentiation, MAPK8/JNK1 and Ras pathway signaling, MAPK1/3 (ERK1/2) pathway signaling, cell survival, and regulation of cell shape and adhesion. [provided by RefSeq, Jan 2017]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit partial embryonic lethality. Mice homozygous for a knock-in allele display partial embryonic and perinatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik G A 17: 9,226,737 (GRCm39) W467* probably null Het
4921509C19Rik A T 2: 151,313,285 (GRCm39) probably benign Het
Actl6b G A 5: 137,552,918 (GRCm39) M82I probably benign Het
Bmp2 T A 2: 133,403,254 (GRCm39) D268E probably damaging Het
Cacng7 T A 7: 3,415,298 (GRCm39) L221H probably damaging Het
Ccser2 A G 14: 36,601,712 (GRCm39) V224A probably damaging Het
Cdc40 A G 10: 40,733,576 (GRCm39) F125L probably damaging Het
Cfap46 C T 7: 139,211,979 (GRCm39) A1669T unknown Het
Cfap58 A T 19: 47,941,535 (GRCm39) E301V probably damaging Het
Clcn2 C A 16: 20,532,168 (GRCm39) G96C probably damaging Het
Cotl1 T A 8: 120,536,944 (GRCm39) probably benign Het
Cps1 G A 1: 67,216,110 (GRCm39) A812T probably damaging Het
Cracd T C 5: 77,006,489 (GRCm39) V950A unknown Het
Crnkl1 T C 2: 145,773,350 (GRCm39) probably null Het
Cry1 A G 10: 84,992,969 (GRCm39) V83A probably benign Het
Cyp2a5 G T 7: 26,540,530 (GRCm39) R381L probably damaging Het
Cyp46a1 T C 12: 108,327,462 (GRCm39) F425L probably damaging Het
Dek A T 13: 47,252,930 (GRCm39) N158K unknown Het
Dgcr8 T A 16: 18,076,161 (GRCm39) Q674L probably damaging Het
Dlec1 C A 9: 118,941,650 (GRCm39) S345R probably benign Het
Dnah7b T A 1: 46,273,305 (GRCm39) C2478S possibly damaging Het
Dstyk T A 1: 132,361,963 (GRCm39) L131Q probably damaging Het
Fbxw7 T A 3: 84,862,227 (GRCm39) L186M Het
Fn1 T C 1: 71,644,239 (GRCm39) Q1684R probably benign Het
Fsip2 C A 2: 82,813,453 (GRCm39) H3257Q possibly damaging Het
Gm5773 T C 3: 93,681,042 (GRCm39) V238A probably damaging Het
Gm9611 T C 14: 42,116,657 (GRCm39) D131G Het
Gpatch8 T C 11: 102,371,018 (GRCm39) E840G unknown Het
Grm5 G A 7: 87,453,176 (GRCm39) R271Q probably damaging Het
Has3 A T 8: 107,601,135 (GRCm39) Y199F probably damaging Het
Hmcn2 A G 2: 31,315,393 (GRCm39) N3714S probably benign Het
Idh1 CA CAA 1: 65,204,347 (GRCm39) probably null Het
Il2 T A 3: 37,177,282 (GRCm39) T85S possibly damaging Het
Kank4 T C 4: 98,668,273 (GRCm39) H58R possibly damaging Het
Kcnk4 T A 19: 6,905,379 (GRCm39) I154F probably damaging Het
Krt1c T C 15: 101,724,379 (GRCm39) K295R possibly damaging Het
Lipm A T 19: 34,090,308 (GRCm39) D163V probably damaging Het
Lpl A G 8: 69,340,215 (GRCm39) N70S probably damaging Het
Mgme1 A G 2: 144,114,451 (GRCm39) probably benign Het
Mnd1 T A 3: 83,995,432 (GRCm39) E187D probably benign Het
Morn5 A G 2: 35,969,533 (GRCm39) D149G probably benign Het
Mrrf G A 2: 36,037,965 (GRCm39) V79I probably damaging Het
Msh4 T A 3: 153,563,270 (GRCm39) Q896L probably benign Het
Mtus2 A C 5: 148,015,303 (GRCm39) M699L possibly damaging Het
Mycbp T A 4: 123,803,880 (GRCm39) C130S unknown Het
Ntn5 A T 7: 45,333,899 (GRCm39) Y4F probably benign Het
Or7e174 T C 9: 20,012,580 (GRCm39) V175A probably benign Het
Osm A G 11: 4,189,839 (GRCm39) S208G probably benign Het
Pcsk6 T A 7: 65,578,891 (GRCm39) Y222N possibly damaging Het
Pde6a A G 18: 61,390,104 (GRCm39) E486G probably benign Het
Pdzk1 T A 3: 96,758,910 (GRCm39) L105Q possibly damaging Het
Rab4b T C 7: 26,874,148 (GRCm39) I90V Het
Rc3h1 T C 1: 160,795,222 (GRCm39) V1083A probably benign Het
Rfx7 C T 9: 72,524,316 (GRCm39) T502I probably benign Het
Rtn4rl2 T C 2: 84,702,558 (GRCm39) Y332C probably damaging Het
Senp2 A G 16: 21,846,789 (GRCm39) T265A probably benign Het
Slc38a3 T C 9: 107,532,345 (GRCm39) M396V probably benign Het
Sord G A 2: 122,094,607 (GRCm39) V332I probably benign Het
Sprr1b GTGGCAGGGCTCAGGAGCCTTGGGGTGGCAGGGCTCAGGAGCCTTGGGATGGCAGGGCTCAGGAGCCTTGGGGTGGCAGGGCTCAGGA GTGGCAGGGCTCAGGAGCCTTGGGGTGGCAGGGCTCAGGA 3: 92,344,653 (GRCm39) probably benign Het
Star G A 8: 26,299,577 (GRCm39) R53H probably benign Het
Stard4 T G 18: 33,336,749 (GRCm39) I189L possibly damaging Het
Stk38 G T 17: 29,219,094 (GRCm39) T7K probably benign Het
Stxbp5 T A 10: 9,713,859 (GRCm39) K227* probably null Het
Taf4b C T 18: 14,946,485 (GRCm39) P436L possibly damaging Het
Tgm3 T A 2: 129,889,702 (GRCm39) V632E probably damaging Het
Tmem158 A G 9: 123,089,309 (GRCm39) F101S probably damaging Het
Trmt10b T C 4: 45,301,281 (GRCm39) S77P probably benign Het
Ttn A T 2: 76,720,307 (GRCm39) L6973* probably null Het
Tubal3 T C 13: 3,983,293 (GRCm39) F358L probably damaging Het
Tut4 T C 4: 108,406,575 (GRCm39) V1381A possibly damaging Het
Vmn1r214 C T 13: 23,219,273 (GRCm39) L256F possibly damaging Het
Vmn2r86 A G 10: 130,282,396 (GRCm39) V740A probably benign Het
Yipf1 A T 4: 107,193,355 (GRCm39) E80D probably benign Het
Zdhhc2 G T 8: 40,898,846 (GRCm39) probably null Het
Zfp655 C T 5: 145,181,290 (GRCm39) H383Y probably damaging Het
Zfp981 C T 4: 146,622,410 (GRCm39) T445I possibly damaging Het
Other mutations in Prkd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00497:Prkd1 APN 12 50,430,264 (GRCm39) missense probably damaging 1.00
IGL00727:Prkd1 APN 12 50,411,444 (GRCm39) missense probably damaging 1.00
IGL00772:Prkd1 APN 12 50,430,199 (GRCm39) missense probably damaging 0.99
IGL01092:Prkd1 APN 12 50,430,298 (GRCm39) splice site probably benign
IGL01457:Prkd1 APN 12 50,439,693 (GRCm39) nonsense probably null
IGL01538:Prkd1 APN 12 50,388,925 (GRCm39) missense probably benign
IGL01762:Prkd1 APN 12 50,434,013 (GRCm39) missense probably benign 0.00
IGL01876:Prkd1 APN 12 50,413,131 (GRCm39) missense probably damaging 1.00
IGL01973:Prkd1 APN 12 50,413,162 (GRCm39) missense probably damaging 1.00
IGL02086:Prkd1 APN 12 50,434,046 (GRCm39) missense probably benign
IGL02293:Prkd1 APN 12 50,536,761 (GRCm39) missense probably damaging 0.97
IGL02454:Prkd1 APN 12 50,411,456 (GRCm39) missense probably benign 0.09
IGL03309:Prkd1 APN 12 50,435,207 (GRCm39) missense probably damaging 1.00
R0349:Prkd1 UTSW 12 50,413,139 (GRCm39) missense probably damaging 1.00
R0457:Prkd1 UTSW 12 50,413,155 (GRCm39) missense probably damaging 0.99
R0627:Prkd1 UTSW 12 50,536,824 (GRCm39) missense probably benign 0.00
R0899:Prkd1 UTSW 12 50,431,976 (GRCm39) missense probably damaging 0.98
R1219:Prkd1 UTSW 12 50,435,125 (GRCm39) missense probably damaging 1.00
R1495:Prkd1 UTSW 12 50,413,135 (GRCm39) missense probably damaging 1.00
R1584:Prkd1 UTSW 12 50,472,298 (GRCm39) missense probably damaging 1.00
R1665:Prkd1 UTSW 12 50,441,709 (GRCm39) missense probably damaging 1.00
R1666:Prkd1 UTSW 12 50,441,709 (GRCm39) missense probably damaging 1.00
R1668:Prkd1 UTSW 12 50,441,709 (GRCm39) missense probably damaging 1.00
R1669:Prkd1 UTSW 12 50,441,709 (GRCm39) missense probably damaging 1.00
R1735:Prkd1 UTSW 12 50,388,822 (GRCm39) missense possibly damaging 0.79
R1939:Prkd1 UTSW 12 50,441,777 (GRCm39) missense probably benign 0.00
R2143:Prkd1 UTSW 12 50,536,694 (GRCm39) missense possibly damaging 0.77
R2145:Prkd1 UTSW 12 50,536,694 (GRCm39) missense possibly damaging 0.77
R3404:Prkd1 UTSW 12 50,695,687 (GRCm39) missense unknown
R3801:Prkd1 UTSW 12 50,430,205 (GRCm39) missense possibly damaging 0.89
R3818:Prkd1 UTSW 12 50,466,667 (GRCm39) splice site probably benign
R3906:Prkd1 UTSW 12 50,435,209 (GRCm39) missense possibly damaging 0.91
R3966:Prkd1 UTSW 12 50,439,724 (GRCm39) missense probably benign 0.44
R4179:Prkd1 UTSW 12 50,413,231 (GRCm39) missense probably damaging 1.00
R4510:Prkd1 UTSW 12 50,439,762 (GRCm39) missense possibly damaging 0.81
R4511:Prkd1 UTSW 12 50,439,762 (GRCm39) missense possibly damaging 0.81
R4663:Prkd1 UTSW 12 50,466,631 (GRCm39) splice site probably null
R4896:Prkd1 UTSW 12 50,436,745 (GRCm39) missense probably damaging 1.00
R5070:Prkd1 UTSW 12 50,441,405 (GRCm39) nonsense probably null
R5263:Prkd1 UTSW 12 50,435,089 (GRCm39) missense probably damaging 1.00
R5389:Prkd1 UTSW 12 50,389,920 (GRCm39) missense probably damaging 1.00
R5395:Prkd1 UTSW 12 50,438,215 (GRCm39) missense probably damaging 1.00
R5855:Prkd1 UTSW 12 50,439,699 (GRCm39) missense probably benign 0.03
R5967:Prkd1 UTSW 12 50,411,333 (GRCm39) missense probably damaging 0.99
R5973:Prkd1 UTSW 12 50,435,038 (GRCm39) missense probably damaging 0.99
R6052:Prkd1 UTSW 12 50,413,083 (GRCm39) critical splice donor site probably null
R6063:Prkd1 UTSW 12 50,388,826 (GRCm39) missense probably benign 0.02
R6309:Prkd1 UTSW 12 50,441,443 (GRCm39) nonsense probably null
R6518:Prkd1 UTSW 12 50,472,278 (GRCm39) missense probably benign 0.08
R6868:Prkd1 UTSW 12 50,472,320 (GRCm39) missense probably damaging 1.00
R7256:Prkd1 UTSW 12 50,435,125 (GRCm39) missense possibly damaging 0.88
R7346:Prkd1 UTSW 12 50,695,617 (GRCm39) missense possibly damaging 0.86
R7815:Prkd1 UTSW 12 50,472,300 (GRCm39) missense probably damaging 1.00
R8290:Prkd1 UTSW 12 50,388,799 (GRCm39) missense probably damaging 1.00
R8397:Prkd1 UTSW 12 50,439,675 (GRCm39) missense probably benign
R8671:Prkd1 UTSW 12 50,435,191 (GRCm39) missense probably benign 0.00
R8805:Prkd1 UTSW 12 50,435,155 (GRCm39) missense probably benign 0.45
R8839:Prkd1 UTSW 12 50,389,616 (GRCm39) intron probably benign
R9005:Prkd1 UTSW 12 50,430,185 (GRCm39) nonsense probably null
R9273:Prkd1 UTSW 12 50,472,232 (GRCm39) missense possibly damaging 0.94
R9281:Prkd1 UTSW 12 50,536,758 (GRCm39) missense probably benign 0.31
R9480:Prkd1 UTSW 12 50,435,283 (GRCm39) missense probably benign 0.19
R9497:Prkd1 UTSW 12 50,438,107 (GRCm39) critical splice donor site probably null
X0024:Prkd1 UTSW 12 50,536,757 (GRCm39) missense probably benign 0.31
X0062:Prkd1 UTSW 12 50,441,705 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTGGGGAAAGCAGCAGGTC -3'
(R):5'- ATCGGCATGATTTTGGTTAACC -3'

Sequencing Primer
(F):5'- AAGCAGCAGGTCTCTTACTG -3'
(R):5'- GGTTAACCACATTTACCATTCTTTG -3'
Posted On 2021-04-30