Incidental Mutation 'R8805:Clcn2'
ID 672029
Institutional Source Beutler Lab
Gene Symbol Clcn2
Ensembl Gene ENSMUSG00000022843
Gene Name chloride channel, voltage-sensitive 2
Synonyms ClC-2, nmf240, Clc2
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.378) question?
Stock # R8805 (G1)
Quality Score 225.009
Status Validated
Chromosome 16
Chromosomal Location 20702964-20717746 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 20713418 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glycine to Cysteine at position 96 (G96C)
Ref Sequence ENSEMBL: ENSMUSP00000007207 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007207] [ENSMUST00000021405] [ENSMUST00000120099] [ENSMUST00000131522] [ENSMUST00000161038] [ENSMUST00000231392] [ENSMUST00000231656] [ENSMUST00000232309]
AlphaFold Q9R0A1
Predicted Effect probably damaging
Transcript: ENSMUST00000007207
AA Change: G96C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000007207
Gene: ENSMUSG00000022843
AA Change: G96C

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
low complexity region 102 111 N/A INTRINSIC
Pfam:Voltage_CLC 151 555 1.2e-94 PFAM
Blast:CBS 595 644 3e-12 BLAST
low complexity region 666 680 N/A INTRINSIC
CBS 803 850 3.69e0 SMART
low complexity region 869 881 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000021405
SMART Domains Protein: ENSMUSP00000021405
Gene: ENSMUSG00000021018

DomainStartEndE-ValueType
RPOL8c 2 147 5.28e-93 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000120099
AA Change: G96C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112759
Gene: ENSMUSG00000022843
AA Change: G96C

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
low complexity region 102 111 N/A INTRINSIC
Pfam:Voltage_CLC 151 538 5.6e-77 PFAM
Blast:CBS 578 627 4e-12 BLAST
low complexity region 649 663 N/A INTRINSIC
CBS 786 833 3.69e0 SMART
low complexity region 852 864 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000131522
AA Change: G96C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000122921
Gene: ENSMUSG00000022843
AA Change: G96C

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
low complexity region 102 111 N/A INTRINSIC
Pfam:Voltage_CLC 151 473 4.2e-63 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161038
Predicted Effect probably benign
Transcript: ENSMUST00000231381
Predicted Effect probably benign
Transcript: ENSMUST00000231392
Predicted Effect probably benign
Transcript: ENSMUST00000231656
Predicted Effect probably benign
Transcript: ENSMUST00000232309
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 96% (70/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a voltage-gated chloride channel. The encoded protein is a transmembrane protein that maintains chloride ion homeostasis in various cells. Defects in this gene may be a cause of certain epilepsies. Four transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2012]
PHENOTYPE: Mice homozygous for a null allele exhibit abnormal brain morphology, male infertility, and abnormal eye morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik G A 17: 9,007,905 W467* probably null Het
4921509C19Rik A T 2: 151,471,365 probably benign Het
Actl6b G A 5: 137,554,656 M82I probably benign Het
Bmp2 T A 2: 133,561,334 D268E probably damaging Het
C530008M17Rik T C 5: 76,858,642 V950A unknown Het
Cacng7 T A 7: 3,366,782 L221H probably damaging Het
Ccser2 A G 14: 36,879,755 V224A probably damaging Het
Cdc40 A G 10: 40,857,580 F125L probably damaging Het
Cfap46 C T 7: 139,632,063 A1669T unknown Het
Cfap58 A T 19: 47,953,096 E301V probably damaging Het
Cotl1 T A 8: 119,810,205 probably benign Het
Cps1 G A 1: 67,176,951 A812T probably damaging Het
Crnkl1 T C 2: 145,931,430 probably null Het
Cry1 A G 10: 85,157,105 V83A probably benign Het
Cyp2a5 G T 7: 26,841,105 R381L probably damaging Het
Cyp46a1 T C 12: 108,361,203 F425L probably damaging Het
Dek A T 13: 47,099,454 N158K unknown Het
Dgcr8 T A 16: 18,258,297 Q674L probably damaging Het
Dlec1 C A 9: 119,112,582 S345R probably benign Het
Dnah7b T A 1: 46,234,145 C2478S possibly damaging Het
Dstyk T A 1: 132,434,225 L131Q probably damaging Het
Fbxw7 T A 3: 84,954,920 L186M Het
Fn1 T C 1: 71,605,080 Q1684R probably benign Het
Fsip2 C A 2: 82,983,109 H3257Q possibly damaging Het
Gm5773 T C 3: 93,773,735 V238A probably damaging Het
Gm9611 T C 14: 42,294,700 D131G Het
Gpatch8 T C 11: 102,480,192 E840G unknown Het
Grm5 G A 7: 87,803,968 R271Q probably damaging Het
Has3 A T 8: 106,874,503 Y199F probably damaging Het
Hmcn2 A G 2: 31,425,381 N3714S probably benign Het
Idh1 CA CAA 1: 65,165,188 probably null Het
Il2 T A 3: 37,123,133 T85S possibly damaging Het
Kank4 T C 4: 98,780,036 H58R possibly damaging Het
Kcnk4 T A 19: 6,928,011 I154F probably damaging Het
Krt2 T C 15: 101,815,944 K295R possibly damaging Het
Lipm A T 19: 34,112,908 D163V probably damaging Het
Lpl A G 8: 68,887,563 N70S probably damaging Het
Mgme1 A G 2: 144,272,531 probably benign Het
Mnd1 T A 3: 84,088,125 E187D probably benign Het
Morn5 A G 2: 36,079,521 D149G probably benign Het
Mrrf G A 2: 36,147,953 V79I probably damaging Het
Msh4 T A 3: 153,857,633 Q896L probably benign Het
Mtus2 A C 5: 148,078,493 M699L possibly damaging Het
Mycbp T A 4: 123,910,087 C130S unknown Het
Ntn5 A T 7: 45,684,475 Y4F probably benign Het
Olfr868 T C 9: 20,101,284 V175A probably benign Het
Osm A G 11: 4,239,839 S208G probably benign Het
Pcsk6 T A 7: 65,929,143 Y222N possibly damaging Het
Pde6a A G 18: 61,257,033 E486G probably benign Het
Pdzk1 T A 3: 96,851,594 L105Q possibly damaging Het
Prkd1 C G 12: 50,388,372 S524T probably benign Het
Prkd1 T A 12: 50,388,373 S524C probably damaging Het
Rab4b T C 7: 27,174,723 I90V Het
Rc3h1 T C 1: 160,967,652 V1083A probably benign Het
Rfx7 C T 9: 72,617,034 T502I probably benign Het
Rtn4rl2 T C 2: 84,872,214 Y332C probably damaging Het
Senp2 A G 16: 22,028,039 T265A probably benign Het
Slc38a3 T C 9: 107,655,146 M396V probably benign Het
Sord G A 2: 122,264,126 V332I probably benign Het
Sprr1b GTGGCAGGGCTCAGGAGCCTTGGGGTGGCAGGGCTCAGGAGCCTTGGGATGGCAGGGCTCAGGAGCCTTGGGGTGGCAGGGCTCAGGA GTGGCAGGGCTCAGGAGCCTTGGGGTGGCAGGGCTCAGGA 3: 92,437,346 probably benign Het
Star G A 8: 25,809,549 R53H probably benign Het
Stard4 T G 18: 33,203,696 I189L possibly damaging Het
Stk38 G T 17: 29,000,120 T7K probably benign Het
Stxbp5 T A 10: 9,838,115 K227* probably null Het
Taf4b C T 18: 14,813,428 P436L possibly damaging Het
Tgm3 T A 2: 130,047,782 V632E probably damaging Het
Tmem158 A G 9: 123,260,244 F101S probably damaging Het
Trmt10b T C 4: 45,301,281 S77P probably benign Het
Ttn A T 2: 76,889,963 L6973* probably null Het
Tubal3 T C 13: 3,933,293 F358L probably damaging Het
Vmn1r214 C T 13: 23,035,103 L256F possibly damaging Het
Vmn2r86 A G 10: 130,446,527 V740A probably benign Het
Yipf1 A T 4: 107,336,158 E80D probably benign Het
Zcchc11 T C 4: 108,549,378 V1381A possibly damaging Het
Zdhhc2 G T 8: 40,445,805 probably null Het
Zfp655 C T 5: 145,244,480 H383Y probably damaging Het
Zfp981 C T 4: 146,537,953 T445I possibly damaging Het
Other mutations in Clcn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00843:Clcn2 APN 16 20703641 missense probably benign 0.08
IGL01657:Clcn2 APN 16 20713619 missense probably damaging 1.00
IGL01797:Clcn2 APN 16 20712761 missense probably damaging 1.00
IGL02557:Clcn2 APN 16 20708464 missense probably damaging 1.00
IGL02624:Clcn2 APN 16 20703348 missense probably damaging 0.98
IGL02819:Clcn2 APN 16 20709256 nonsense probably null
IGL03329:Clcn2 APN 16 20712152 missense probably damaging 1.00
Bemr14 UTSW 16 unclassified
R0008:Clcn2 UTSW 16 20710390 missense probably null 1.00
R0454:Clcn2 UTSW 16 20710428 critical splice acceptor site probably null
R1101:Clcn2 UTSW 16 20703595 missense probably damaging 1.00
R1466:Clcn2 UTSW 16 20712552 splice site probably benign
R1824:Clcn2 UTSW 16 20715962 missense probably benign 0.04
R4592:Clcn2 UTSW 16 20709142 missense probably damaging 0.99
R5011:Clcn2 UTSW 16 20707215 missense probably damaging 1.00
R5013:Clcn2 UTSW 16 20707215 missense probably damaging 1.00
R5154:Clcn2 UTSW 16 20703303 missense probably benign 0.01
R5374:Clcn2 UTSW 16 20709669 missense possibly damaging 0.78
R5726:Clcn2 UTSW 16 20710535 intron probably benign
R5787:Clcn2 UTSW 16 20703433 missense probably damaging 1.00
R5992:Clcn2 UTSW 16 20713654 missense possibly damaging 0.68
R6045:Clcn2 UTSW 16 20711688 critical splice donor site probably null
R6663:Clcn2 UTSW 16 20703245 makesense probably null
R6765:Clcn2 UTSW 16 20707668 splice site probably null
R6825:Clcn2 UTSW 16 20709658 utr 3 prime probably benign
R7872:Clcn2 UTSW 16 20708460 missense probably damaging 0.99
R8028:Clcn2 UTSW 16 20708762 missense possibly damaging 0.66
R8198:Clcn2 UTSW 16 20707196 missense probably damaging 0.99
R8924:Clcn2 UTSW 16 20712180 missense probably damaging 1.00
R8992:Clcn2 UTSW 16 20712330 missense probably damaging 1.00
R9074:Clcn2 UTSW 16 20712664 missense possibly damaging 0.78
R9101:Clcn2 UTSW 16 20707229 missense probably benign 0.00
R9456:Clcn2 UTSW 16 20715952 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- TTATTGCCTGGAGATGGACAGTC -3'
(R):5'- CAGTAAGATCCAGATTGGGGC -3'

Sequencing Primer
(F):5'- CAGTCAGACTGGCCAGAGG -3'
(R):5'- TCCAGATTGGGGCAGGGAC -3'
Posted On 2021-04-30