Incidental Mutation 'R8805:Stard4'
ID672035
Institutional Source Beutler Lab
Gene Symbol Stard4
Ensembl Gene ENSMUSG00000024378
Gene NameStAR-related lipid transfer (START) domain containing 4
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8805 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location33199355-33213862 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 33203696 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 189 (I189L)
Ref Sequence ENSEMBL: ENSMUSP00000025236 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025236] [ENSMUST00000118990] [ENSMUST00000119991]
Predicted Effect possibly damaging
Transcript: ENSMUST00000025236
AA Change: I189L

PolyPhen 2 Score 0.929 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000025236
Gene: ENSMUSG00000024378
AA Change: I189L

DomainStartEndE-ValueType
START 25 224 1.43e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000118990
SMART Domains Protein: ENSMUSP00000114131
Gene: ENSMUSG00000024378

DomainStartEndE-ValueType
PDB:1JSS|B 1 110 5e-78 PDB
SCOP:d1jssa_ 24 110 3e-17 SMART
Blast:START 25 110 4e-58 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000119991
SMART Domains Protein: ENSMUSP00000114109
Gene: ENSMUSG00000024378

DomainStartEndE-ValueType
PDB:1JSS|B 1 110 1e-76 PDB
SCOP:d1jssa_ 24 110 8e-17 SMART
Blast:START 25 110 8e-57 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cholesterol homeostasis is regulated, at least in part, by sterol regulatory element (SRE)-binding proteins (e.g., SREBP1; MIM 184756) and by liver X receptors (e.g., LXRA; MIM 602423). Upon sterol depletion, LXRs are inactive and SREBPs are cleaved, after which they bind promoter SREs and activate genes involved in cholesterol biosynthesis and uptake. Sterol transport is mediated by vesicles or by soluble protein carriers, such as steroidogenic acute regulatory protein (STAR; MIM 600617). STAR is homologous to a family of proteins containing a 200- to 210-amino acid STAR-related lipid transfer (START) domain, including STARD4 (Soccio et al., 2002 [PubMed 12011452]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased liver weight, body weight, and body length. Female mice homozygous for this allele exhibit decreased circulating cholesterol when fed a low cholesterol diet and altered bile composition when fed standard chow. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik G A 17: 9,007,905 W467* probably null Het
Actl6b G A 5: 137,554,656 M82I probably benign Het
Bmp2 T A 2: 133,561,334 D268E probably damaging Het
C530008M17Rik T C 5: 76,858,642 V950A unknown Het
Cacng7 T A 7: 3,366,782 L221H probably damaging Het
Ccser2 A G 14: 36,879,755 V224A probably damaging Het
Cdc40 A G 10: 40,857,580 F125L probably damaging Het
Cfap46 C T 7: 139,632,063 A1669T unknown Het
Cfap58 A T 19: 47,953,096 E301V probably damaging Het
Clcn2 C A 16: 20,713,418 G96C probably damaging Het
Cps1 G A 1: 67,176,951 A812T probably damaging Het
Crnkl1 T C 2: 145,931,430 probably null Het
Cry1 A G 10: 85,157,105 V83A probably benign Het
Cyp2a5 G T 7: 26,841,105 R381L probably damaging Het
Cyp46a1 T C 12: 108,361,203 F425L probably damaging Het
Dek A T 13: 47,099,454 N158K unknown Het
Dgcr8 T A 16: 18,258,297 Q674L probably damaging Het
Dlec1 C A 9: 119,112,582 S345R probably benign Het
Dnah7b T A 1: 46,234,145 C2478S possibly damaging Het
Dnah8 CGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTT CGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTT 17: 30,760,867 probably null Het
Dstyk T A 1: 132,434,225 L131Q probably damaging Het
Fbxw7 T A 3: 84,954,920 L186M Het
Fn1 T C 1: 71,605,080 Q1684R probably benign Het
Fsip2 C A 2: 82,983,109 H3257Q possibly damaging Het
Gm5773 T C 3: 93,773,735 V238A probably damaging Het
Gm9611 T C 14: 42,294,700 D131G Het
Gpatch8 T C 11: 102,480,192 E840G unknown Het
Grm5 G A 7: 87,803,968 R271Q probably damaging Het
Has3 A T 8: 106,874,503 Y199F probably damaging Het
Hmcn2 A G 2: 31,425,381 N3714S probably benign Het
Idh1 CA CAA 1: 65,165,188 probably null Het
Il2 T A 3: 37,123,133 T85S possibly damaging Het
Kank4 T C 4: 98,780,036 H58R possibly damaging Het
Kcnk4 T A 19: 6,928,011 I154F probably damaging Het
Krt2 T C 15: 101,815,944 K295R possibly damaging Het
Lipm A T 19: 34,112,908 D163V probably damaging Het
Lpl A G 8: 68,887,563 N70S probably damaging Het
Mnd1 T A 3: 84,088,125 E187D probably benign Het
Morn5 A G 2: 36,079,521 D149G probably benign Het
Mrrf G A 2: 36,147,953 V79I probably damaging Het
Msh4 T A 3: 153,857,633 Q896L probably benign Het
Mtus2 A C 5: 148,078,493 M699L possibly damaging Het
Mycbp T A 4: 123,910,087 C130S unknown Het
Ntn5 A T 7: 45,684,475 Y4F probably benign Het
Olfr868 T C 9: 20,101,284 V175A probably benign Het
Osm A G 11: 4,239,839 S208G probably benign Het
Pcsk6 T A 7: 65,929,143 Y222N possibly damaging Het
Pde6a A G 18: 61,257,033 E486G probably benign Het
Pdzk1 T A 3: 96,851,594 L105Q possibly damaging Het
Prkd1 C G 12: 50,388,372 S524T probably benign Het
Prkd1 T A 12: 50,388,373 S524C probably damaging Het
Rab4b T C 7: 27,174,723 I90V Het
Rc3h1 T C 1: 160,967,652 V1083A probably benign Het
Rfx7 C T 9: 72,617,034 T502I probably benign Het
Rtn4rl2 T C 2: 84,872,214 Y332C probably damaging Het
Senp2 A G 16: 22,028,039 T265A probably benign Het
Slc38a3 T C 9: 107,655,146 M396V probably benign Het
Sord G A 2: 122,264,126 V332I probably benign Het
Sprr1b GTGGCAGGGCTCAGGAGCCTTGGGGTGGCAGGGCTCAGGAGCCTTGGGATGGCAGGGCTCAGGAGCCTTGGGGTGGCAGGGCTCAGGA GTGGCAGGGCTCAGGAGCCTTGGGGTGGCAGGGCTCAGGA 3: 92,437,346 probably benign Het
Star G A 8: 25,809,549 R53H probably benign Het
Stk38 G T 17: 29,000,120 T7K probably benign Het
Stxbp5 T A 10: 9,838,115 K227* probably null Het
Taf4b C T 18: 14,813,428 P436L possibly damaging Het
Tgm3 T A 2: 130,047,782 V632E probably damaging Het
Tmem158 A G 9: 123,260,244 F101S probably damaging Het
Trmt10b T C 4: 45,301,281 S77P probably benign Het
Ttn A T 2: 76,889,963 L6973* probably null Het
Tubal3 T C 13: 3,933,293 F358L probably damaging Het
Vmn1r214 C T 13: 23,035,103 L256F possibly damaging Het
Vmn2r86 A G 10: 130,446,527 V740A probably benign Het
Yipf1 A T 4: 107,336,158 E80D probably benign Het
Zcchc11 T C 4: 108,549,378 V1381A possibly damaging Het
Zdhhc2 G T 8: 40,445,805 probably null Het
Zfp655 C T 5: 145,244,480 H383Y probably damaging Het
Other mutations in Stard4
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0462:Stard4 UTSW 18 33205149 missense probably damaging 1.00
R1396:Stard4 UTSW 18 33206210 missense probably damaging 0.99
R1577:Stard4 UTSW 18 33205098 missense probably damaging 1.00
R5308:Stard4 UTSW 18 33203625 missense probably damaging 1.00
R5481:Stard4 UTSW 18 33205245 missense probably benign 0.03
R6161:Stard4 UTSW 18 33209056 missense probably damaging 0.99
R6393:Stard4 UTSW 18 33205225 missense probably benign 0.00
R7062:Stard4 UTSW 18 33205534 splice site probably null
R7478:Stard4 UTSW 18 33205324 missense unknown
X0065:Stard4 UTSW 18 33209072 missense probably damaging 0.98
Z1088:Stard4 UTSW 18 33203717 missense probably benign 0.01
Z1088:Stard4 UTSW 18 33203720 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCATGGAGCTGACAGGGTAG -3'
(R):5'- TTGCTGTGCCCAAAACTCCTAG -3'

Sequencing Primer
(F):5'- TAGGAGCAGAGTCCGCAAACC -3'
(R):5'- TGTGCCCAAAACTCCTAGGGATTAG -3'
Posted On2021-04-30