Incidental Mutation 'R8806:Nvl'
ID672041
Institutional Source Beutler Lab
Gene Symbol Nvl
Ensembl Gene ENSMUSG00000026516
Gene Namenuclear VCP-like
Synonyms1200009I24Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.961) question?
Stock #R8806 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location181087138-181144204 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 181095054 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Valine at position 818 (G818V)
Ref Sequence ENSEMBL: ENSMUSP00000027797 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027797]
PDB Structure Structure and function of the N-terminal nucleolin binding domain of nuclear valocine containing protein like 2 (NVL2) harboring a nucleolar localization signal [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000027797
AA Change: G818V

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000027797
Gene: ENSMUSG00000026516
AA Change: G818V

DomainStartEndE-ValueType
Pfam:Nucleolin_bd 2 72 1.9e-31 PFAM
low complexity region 90 104 N/A INTRINSIC
low complexity region 187 201 N/A INTRINSIC
low complexity region 216 230 N/A INTRINSIC
AAA 296 435 2.94e-23 SMART
low complexity region 524 540 N/A INTRINSIC
AAA 613 749 2.56e-23 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the AAA (ATPases associated with diverse cellular activities) superfamily. Multiple transcript variants encoding different isoforms have been found for this gene. Two encoded proteins, described as major and minor isoforms, have been localized to distinct regions of the nucleus. The largest encoded protein (major isoform) has been localized to the nucleolus and shown to participate in ribosome biosynthesis (PMID: 15469983, 16782053), while the minor isoform has been localized to the nucleoplasmin. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik A G 4: 42,971,261 D198G probably benign Het
Abca1 T C 4: 53,084,520 M586V probably benign Het
Adam6b G A 12: 113,491,798 R745H possibly damaging Het
Afg3l1 A G 8: 123,493,918 D462G probably damaging Het
Anapc1 T A 2: 128,622,413 Q1721L possibly damaging Het
Arhgap11a T C 2: 113,834,762 Y497C possibly damaging Het
Bcl7b T G 5: 135,179,970 S96A possibly damaging Het
Birc6 T C 17: 74,642,316 V3111A probably damaging Het
Cbx1 A G 11: 96,801,557 D90G possibly damaging Het
Ccdc105 A G 10: 78,752,472 V168A probably damaging Het
Cdkl3 T C 11: 52,032,468 F524S possibly damaging Het
Cops7b G A 1: 86,589,309 G44R probably damaging Het
D130043K22Rik A G 13: 24,899,635 S1028G probably benign Het
Decr1 T A 4: 15,945,351 M1L probably benign Het
Dmtn T C 14: 70,614,948 I167V probably benign Het
Dnah9 A G 11: 65,859,483 L3932P probably damaging Het
Ece1 T A 4: 137,945,141 I365N probably damaging Het
Exo5 T C 4: 120,922,405 T88A probably benign Het
Frem3 T C 8: 80,663,435 Y1772H probably benign Het
Gm11639 T A 11: 105,037,869 M4815K probably benign Het
Gm5160 A G 18: 14,424,874 N3D possibly damaging Het
Gm7138 T A 10: 77,776,883 D21V unknown Het
Gucy2e A G 11: 69,236,116 V177A probably benign Het
Islr C A 9: 58,156,973 G417V unknown Het
Kif13a A T 13: 46,761,337 M1458K possibly damaging Het
Mcm7 T C 5: 138,165,085 D642G possibly damaging Het
Med24 A T 11: 98,705,144 I941N probably damaging Het
Mrgprb8 C T 7: 48,389,228 P216S possibly damaging Het
Myo5c T A 9: 75,242,772 V13D probably damaging Het
N4bp2 T A 5: 65,808,208 I1200K possibly damaging Het
Naip6 G A 13: 100,300,653 T454M possibly damaging Het
Nfkb1 T C 3: 135,589,452 Y877C probably damaging Het
Nolc1 C A 19: 46,083,032 S473R unknown Het
Nop16 A C 13: 54,589,859 probably benign Het
Nr3c2 T C 8: 77,242,463 I959T probably damaging Het
Nup88 T G 11: 70,944,115 K692N probably benign Het
Olfr1046 T C 2: 86,216,856 I285V probably damaging Het
Olfr1193 T C 2: 88,678,611 V245A probably benign Het
Olfr1357 G T 10: 78,612,140 T167N probably benign Het
Olfr731 T A 14: 50,237,919 E322V probably benign Het
Olfr732 A G 14: 50,281,779 I158T probably benign Het
Olfr913 A T 9: 38,595,109 D296V probably damaging Het
Plxnc1 G A 10: 94,799,278 S1362L probably damaging Het
Ppfia2 C T 10: 106,858,253 A696V probably damaging Het
Prl A G 13: 27,059,532 Y62C probably damaging Het
Rnf135 A G 11: 80,198,936 D366G probably damaging Het
Rrp8 A G 7: 105,735,037 L86P probably damaging Het
Rsph4a T C 10: 33,909,449 V452A probably damaging Het
Runx2 C A 17: 44,639,683 V410L probably benign Het
Samd9l T C 6: 3,376,665 T199A probably damaging Het
Sik3 T C 9: 46,209,067 S745P probably damaging Het
Slc35e1 T A 8: 72,488,129 S250C probably damaging Het
Snx31 A G 15: 36,537,552 F160S probably damaging Het
Stim2 T A 5: 53,998,915 V11E probably benign Het
Tmem135 G C 7: 89,147,978 L357V probably benign Het
Tox4 T C 14: 52,286,861 S151P probably damaging Het
Trim34b A T 7: 104,336,112 D318V probably damaging Het
Ubtd1 T C 19: 42,033,756 S156P probably damaging Het
Usp34 C A 11: 23,484,143 L3240M Het
Vmn1r56 T C 7: 5,195,806 S271G probably damaging Het
Vps13b T C 15: 35,472,066 probably benign Het
Vps13c T C 9: 67,945,828 F2401S probably damaging Het
Zbtb11 G A 16: 55,982,274 V216I probably damaging Het
Zfp931 T C 2: 178,067,796 T266A possibly damaging Het
Zfp956 A G 6: 47,956,108 M106V probably benign Het
Other mutations in Nvl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00848:Nvl APN 1 181105125 missense probably damaging 1.00
IGL00943:Nvl APN 1 181101634 missense possibly damaging 0.72
IGL01956:Nvl APN 1 181134944 missense probably benign 0.00
IGL02657:Nvl APN 1 181106976 missense probably damaging 1.00
nineveh UTSW 1 181136906 missense probably benign 0.00
nubia UTSW 1 181112334 missense probably benign 0.19
IGL03098:Nvl UTSW 1 181093906 missense probably benign 0.37
P0047:Nvl UTSW 1 181112302 missense probably damaging 1.00
R0003:Nvl UTSW 1 181114133 missense probably damaging 1.00
R0114:Nvl UTSW 1 181120391 missense probably benign 0.19
R0265:Nvl UTSW 1 181134830 missense probably damaging 0.96
R0928:Nvl UTSW 1 181093902 missense probably benign 0.00
R1398:Nvl UTSW 1 181097126 splice site probably benign
R1470:Nvl UTSW 1 181139262 missense probably damaging 1.00
R1470:Nvl UTSW 1 181139262 missense probably damaging 1.00
R1529:Nvl UTSW 1 181109159 critical splice donor site probably null
R1934:Nvl UTSW 1 181099128 missense probably damaging 0.96
R2176:Nvl UTSW 1 181135074 splice site probably benign
R2351:Nvl UTSW 1 181130792 missense probably benign 0.03
R4415:Nvl UTSW 1 181105114 missense probably benign
R4570:Nvl UTSW 1 181144082 missense probably benign 0.03
R4720:Nvl UTSW 1 181101587 missense probably damaging 1.00
R4888:Nvl UTSW 1 181117626 missense probably damaging 1.00
R5026:Nvl UTSW 1 181105155 missense probably damaging 1.00
R5507:Nvl UTSW 1 181135036 missense probably damaging 0.98
R5785:Nvl UTSW 1 181139298 missense probably damaging 1.00
R5983:Nvl UTSW 1 181136906 missense probably benign 0.00
R6143:Nvl UTSW 1 181134995 missense probably benign 0.01
R6532:Nvl UTSW 1 181144143 splice site probably null
R6821:Nvl UTSW 1 181126970 nonsense probably null
R7062:Nvl UTSW 1 181112334 missense probably benign 0.19
R7247:Nvl UTSW 1 181112286 critical splice donor site probably null
R7358:Nvl UTSW 1 181135036 missense probably damaging 0.98
R7665:Nvl UTSW 1 181134944 missense probably benign 0.18
R7795:Nvl UTSW 1 181097157 missense probably benign 0.00
R7931:Nvl UTSW 1 181109155 splice site probably benign
R8185:Nvl UTSW 1 181144174 unclassified probably benign
X0067:Nvl UTSW 1 181139158 missense possibly damaging 0.58
Predicted Primers PCR Primer
(F):5'- CCCTACTATACATGTCAGCGAATTG -3'
(R):5'- TCCCAACATTCCTGAGAGACAG -3'

Sequencing Primer
(F):5'- AAGCAGGAGTCTCATCAGTTTG -3'
(R):5'- TGAGAGACAGACCACCTACAG -3'
Posted On2021-04-30