Incidental Mutation 'R8806:Or4s2b'
ID 672043
Institutional Source Beutler Lab
Gene Symbol Or4s2b
Ensembl Gene ENSMUSG00000060827
Gene Name olfactory receptor family 4 subfamily S member 2B
Synonyms MOR230-9, Olfr1194-ps1, MOR226-1, GA_x6K02T2Q125-50158288-50158818, Olfr1193, GA_x6K02T2Q125-50154044-50154826
MMRRC Submission 068612-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.090) question?
Stock # R8806 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 88508201-88509157 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 88508955 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 245 (V245A)
Ref Sequence ENSEMBL: ENSMUSP00000148918 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081697] [ENSMUST00000099818] [ENSMUST00000213545] [ENSMUST00000213893] [ENSMUST00000216767]
AlphaFold A2AV13
Predicted Effect probably benign
Transcript: ENSMUST00000081697
AA Change: V252A

PolyPhen 2 Score 0.078 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000080399
Gene: ENSMUSG00000060827
AA Change: V252A

DomainStartEndE-ValueType
Pfam:7tm_4 36 310 7.5e-51 PFAM
Pfam:7tm_1 46 292 7.3e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000099818
SMART Domains Protein: ENSMUSP00000097406
Gene: ENSMUSG00000075121

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 2.5e-47 PFAM
Pfam:7TM_GPCR_Srsx 32 300 1.6e-5 PFAM
Pfam:7tm_1 39 285 5.2e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213545
Predicted Effect probably benign
Transcript: ENSMUST00000213893
AA Change: V245A

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
Predicted Effect probably benign
Transcript: ENSMUST00000216767
AA Change: V245A

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.4%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 T C 4: 53,084,520 (GRCm39) M586V probably benign Het
Adam6b G A 12: 113,455,418 (GRCm39) R745H possibly damaging Het
Afg3l1 A G 8: 124,220,657 (GRCm39) D462G probably damaging Het
Anapc1 T A 2: 128,464,333 (GRCm39) Q1721L possibly damaging Het
Arhgap11a T C 2: 113,665,107 (GRCm39) Y497C possibly damaging Het
Bcl7b T G 5: 135,208,824 (GRCm39) S96A possibly damaging Het
Birc6 T C 17: 74,949,311 (GRCm39) V3111A probably damaging Het
Cbx1 A G 11: 96,692,383 (GRCm39) D90G possibly damaging Het
Cdkl3 T C 11: 51,923,295 (GRCm39) F524S possibly damaging Het
Cops7b G A 1: 86,517,031 (GRCm39) G44R probably damaging Het
D130043K22Rik A G 13: 25,083,618 (GRCm39) S1028G probably benign Het
Decr1 T A 4: 15,945,351 (GRCm39) M1L probably benign Het
Dmtn T C 14: 70,852,388 (GRCm39) I167V probably benign Het
Dnah9 A G 11: 65,750,309 (GRCm39) L3932P probably damaging Het
Ece1 T A 4: 137,672,452 (GRCm39) I365N probably damaging Het
Efcab3 T A 11: 104,928,695 (GRCm39) M4815K probably benign Het
Exo5 T C 4: 120,779,602 (GRCm39) T88A probably benign Het
Frem3 T C 8: 81,390,064 (GRCm39) Y1772H probably benign Het
Gm5160 A G 18: 14,557,931 (GRCm39) N3D possibly damaging Het
Gm7138 T A 10: 77,612,717 (GRCm39) D21V unknown Het
Gm7298 C A 6: 121,761,641 (GRCm39) silent Het
Gucy2e A G 11: 69,126,942 (GRCm39) V177A probably benign Het
Islr C A 9: 58,064,256 (GRCm39) G417V unknown Het
Kif13a A T 13: 46,914,813 (GRCm39) M1458K possibly damaging Het
Mcm7 T C 5: 138,163,347 (GRCm39) D642G possibly damaging Het
Med24 A T 11: 98,595,970 (GRCm39) I941N probably damaging Het
Mrgprb8 C T 7: 48,038,976 (GRCm39) P216S possibly damaging Het
Myo5c T A 9: 75,150,054 (GRCm39) V13D probably damaging Het
N4bp2 T A 5: 65,965,551 (GRCm39) I1200K possibly damaging Het
Naip6 G A 13: 100,437,161 (GRCm39) T454M possibly damaging Het
Nfkb1 T C 3: 135,295,213 (GRCm39) Y877C probably damaging Het
Nolc1 C A 19: 46,071,471 (GRCm39) S473R unknown Het
Nop16 A C 13: 54,737,672 (GRCm39) probably benign Het
Nr3c2 T C 8: 77,969,092 (GRCm39) I959T probably damaging Het
Nup88 T G 11: 70,834,941 (GRCm39) K692N probably benign Het
Nvl C A 1: 180,922,619 (GRCm39) G818V probably benign Het
Or1i2 G T 10: 78,447,974 (GRCm39) T167N probably benign Het
Or4k6 T A 14: 50,475,376 (GRCm39) E322V probably benign Het
Or4n4 A G 14: 50,519,236 (GRCm39) I158T probably benign Het
Or8b49 A T 9: 38,506,405 (GRCm39) D296V probably damaging Het
Or8k1 T C 2: 86,047,200 (GRCm39) I285V probably damaging Het
Plxnc1 G A 10: 94,635,140 (GRCm39) S1362L probably damaging Het
Ppfia2 C T 10: 106,694,114 (GRCm39) A696V probably damaging Het
Prl A G 13: 27,243,515 (GRCm39) Y62C probably damaging Het
Rnf135 A G 11: 80,089,762 (GRCm39) D366G probably damaging Het
Rrp8 A G 7: 105,384,244 (GRCm39) L86P probably damaging Het
Rsph4a T C 10: 33,785,445 (GRCm39) V452A probably damaging Het
Runx2 C A 17: 44,950,570 (GRCm39) V410L probably benign Het
Samd9l T C 6: 3,376,665 (GRCm39) T199A probably damaging Het
Sik3 T C 9: 46,120,365 (GRCm39) S745P probably damaging Het
Slc35e1 T A 8: 73,241,973 (GRCm39) S250C probably damaging Het
Snx31 A G 15: 36,537,698 (GRCm39) F160S probably damaging Het
Spata31g1 A G 4: 42,971,261 (GRCm39) D198G probably benign Het
Stim2 T A 5: 54,156,257 (GRCm39) V11E probably benign Het
Tektl1 A G 10: 78,588,306 (GRCm39) V168A probably damaging Het
Tmem135 G C 7: 88,797,186 (GRCm39) L357V probably benign Het
Tox4 T C 14: 52,524,318 (GRCm39) S151P probably damaging Het
Trim34b A T 7: 103,985,319 (GRCm39) D318V probably damaging Het
Ubtd1 T C 19: 42,022,195 (GRCm39) S156P probably damaging Het
Usp34 C A 11: 23,434,143 (GRCm39) L3240M Het
Vmn1r56 T C 7: 5,198,805 (GRCm39) S271G probably damaging Het
Vps13b T C 15: 35,472,212 (GRCm39) probably benign Het
Vps13c T C 9: 67,853,110 (GRCm39) F2401S probably damaging Het
Zbtb11 G A 16: 55,802,637 (GRCm39) V216I probably damaging Het
Zfp931 T C 2: 177,709,589 (GRCm39) T266A possibly damaging Het
Zfp956 A G 6: 47,933,042 (GRCm39) M106V probably benign Het
Other mutations in Or4s2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01939:Or4s2b APN 2 88,509,077 (GRCm39) missense probably damaging 1.00
R0322:Or4s2b UTSW 2 88,509,011 (GRCm39) missense probably damaging 0.98
R0711:Or4s2b UTSW 2 88,509,018 (GRCm39) missense probably damaging 1.00
R1500:Or4s2b UTSW 2 88,508,219 (GRCm39) missense possibly damaging 0.73
R1610:Or4s2b UTSW 2 88,508,918 (GRCm39) nonsense probably null
R4380:Or4s2b UTSW 2 88,508,615 (GRCm39) missense possibly damaging 0.61
R4602:Or4s2b UTSW 2 88,508,523 (GRCm39) missense probably benign
R4602:Or4s2b UTSW 2 88,508,240 (GRCm39) missense probably benign 0.08
R4610:Or4s2b UTSW 2 88,508,523 (GRCm39) missense probably benign
R4610:Or4s2b UTSW 2 88,508,240 (GRCm39) missense probably benign 0.08
R4790:Or4s2b UTSW 2 88,508,731 (GRCm39) missense possibly damaging 0.73
R4803:Or4s2b UTSW 2 88,508,366 (GRCm39) missense probably benign 0.34
R5402:Or4s2b UTSW 2 88,508,492 (GRCm39) missense possibly damaging 0.74
R5736:Or4s2b UTSW 2 88,508,985 (GRCm39) missense probably benign 0.00
R6896:Or4s2b UTSW 2 88,508,340 (GRCm39) missense probably damaging 1.00
R6998:Or4s2b UTSW 2 88,508,852 (GRCm39) missense probably benign 0.23
R7038:Or4s2b UTSW 2 88,509,085 (GRCm39) missense probably damaging 1.00
R9285:Or4s2b UTSW 2 88,508,680 (GRCm39) missense probably damaging 1.00
X0022:Or4s2b UTSW 2 88,508,664 (GRCm39) missense probably benign 0.08
Z1088:Or4s2b UTSW 2 88,509,008 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCTGCACTGACACTTACATTG -3'
(R):5'- ACAATGGCATTAGTCAAGGCTAAAG -3'

Sequencing Primer
(F):5'- GTTGGTATTTTTGTGACAGCAAACAG -3'
(R):5'- CCAGTAGTTTCCCAGGAAAACTTTC -3'
Posted On 2021-04-30