Incidental Mutation 'R8806:Arhgap11a'
ID672044
Institutional Source Beutler Lab
Gene Symbol Arhgap11a
Ensembl Gene ENSMUSG00000041219
Gene NameRho GTPase activating protein 11A
SynonymsGAP (1-12), 6530401L14Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8806 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location113831492-113848661 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 113834762 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 497 (Y497C)
Ref Sequence ENSEMBL: ENSMUSP00000106572 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102545] [ENSMUST00000110947] [ENSMUST00000110948] [ENSMUST00000110949]
Predicted Effect probably benign
Transcript: ENSMUST00000102545
SMART Domains Protein: ENSMUSP00000099604
Gene: ENSMUSG00000041219

DomainStartEndE-ValueType
low complexity region 4 18 N/A INTRINSIC
RhoGAP 63 236 1.97e-47 SMART
Blast:RhoGAP 288 349 3e-20 BLAST
low complexity region 490 501 N/A INTRINSIC
low complexity region 719 738 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000110947
AA Change: Y497C

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000106572
Gene: ENSMUSG00000041219
AA Change: Y497C

DomainStartEndE-ValueType
low complexity region 4 18 N/A INTRINSIC
RhoGAP 63 236 1.97e-47 SMART
Blast:RhoGAP 288 349 7e-21 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000110948
SMART Domains Protein: ENSMUSP00000106573
Gene: ENSMUSG00000041219

DomainStartEndE-ValueType
low complexity region 4 18 N/A INTRINSIC
RhoGAP 63 236 1.97e-47 SMART
Blast:RhoGAP 288 349 6e-21 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000110949
SMART Domains Protein: ENSMUSP00000106574
Gene: ENSMUSG00000041219

DomainStartEndE-ValueType
low complexity region 4 18 N/A INTRINSIC
RhoGAP 63 236 1.97e-47 SMART
Blast:RhoGAP 288 349 3e-20 BLAST
low complexity region 490 501 N/A INTRINSIC
low complexity region 719 738 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Rho GTPase activating protein family. In response to DNA damage, the encoded protein interacts with the p53 tumor suppressor protein and stimulates its tetramerization, which results in cell-cycle arrest and apoptosis. A chromosomal deletion that includes this gene is one cause of Prader-Willi syndrome, and an intronic variant of this gene may be associated with sleep duration in children. This gene is highly expressed in colon cancers and in a human basal-like breast cancer cell line. [provided by RefSeq, Sep 2016]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik A G 4: 42,971,261 D198G probably benign Het
Abca1 T C 4: 53,084,520 M586V probably benign Het
Adam6b G A 12: 113,491,798 R745H possibly damaging Het
Afg3l1 A G 8: 123,493,918 D462G probably damaging Het
Anapc1 T A 2: 128,622,413 Q1721L possibly damaging Het
Bcl7b T G 5: 135,179,970 S96A possibly damaging Het
Birc6 T C 17: 74,642,316 V3111A probably damaging Het
Cbx1 A G 11: 96,801,557 D90G possibly damaging Het
Ccdc105 A G 10: 78,752,472 V168A probably damaging Het
Cdkl3 T C 11: 52,032,468 F524S possibly damaging Het
Cops7b G A 1: 86,589,309 G44R probably damaging Het
D130043K22Rik A G 13: 24,899,635 S1028G probably benign Het
Decr1 T A 4: 15,945,351 M1L probably benign Het
Dmtn T C 14: 70,614,948 I167V probably benign Het
Dnah9 A G 11: 65,859,483 L3932P probably damaging Het
Ece1 T A 4: 137,945,141 I365N probably damaging Het
Exo5 T C 4: 120,922,405 T88A probably benign Het
Frem3 T C 8: 80,663,435 Y1772H probably benign Het
Gm11639 T A 11: 105,037,869 M4815K probably benign Het
Gm5160 A G 18: 14,424,874 N3D possibly damaging Het
Gm7138 T A 10: 77,776,883 D21V unknown Het
Gucy2e A G 11: 69,236,116 V177A probably benign Het
Islr C A 9: 58,156,973 G417V unknown Het
Kif13a A T 13: 46,761,337 M1458K possibly damaging Het
Mcm7 T C 5: 138,165,085 D642G possibly damaging Het
Med24 A T 11: 98,705,144 I941N probably damaging Het
Mrgprb8 C T 7: 48,389,228 P216S possibly damaging Het
Myo5c T A 9: 75,242,772 V13D probably damaging Het
N4bp2 T A 5: 65,808,208 I1200K possibly damaging Het
Naip6 G A 13: 100,300,653 T454M possibly damaging Het
Nfkb1 T C 3: 135,589,452 Y877C probably damaging Het
Nolc1 C A 19: 46,083,032 S473R unknown Het
Nop16 A C 13: 54,589,859 probably benign Het
Nr3c2 T C 8: 77,242,463 I959T probably damaging Het
Nup88 T G 11: 70,944,115 K692N probably benign Het
Nvl C A 1: 181,095,054 G818V probably benign Het
Olfr1046 T C 2: 86,216,856 I285V probably damaging Het
Olfr1193 T C 2: 88,678,611 V245A probably benign Het
Olfr1357 G T 10: 78,612,140 T167N probably benign Het
Olfr731 T A 14: 50,237,919 E322V probably benign Het
Olfr732 A G 14: 50,281,779 I158T probably benign Het
Olfr913 A T 9: 38,595,109 D296V probably damaging Het
Plxnc1 G A 10: 94,799,278 S1362L probably damaging Het
Ppfia2 C T 10: 106,858,253 A696V probably damaging Het
Prl A G 13: 27,059,532 Y62C probably damaging Het
Rnf135 A G 11: 80,198,936 D366G probably damaging Het
Rrp8 A G 7: 105,735,037 L86P probably damaging Het
Rsph4a T C 10: 33,909,449 V452A probably damaging Het
Runx2 C A 17: 44,639,683 V410L probably benign Het
Samd9l T C 6: 3,376,665 T199A probably damaging Het
Sik3 T C 9: 46,209,067 S745P probably damaging Het
Slc35e1 T A 8: 72,488,129 S250C probably damaging Het
Snx31 A G 15: 36,537,552 F160S probably damaging Het
Stim2 T A 5: 53,998,915 V11E probably benign Het
Tmem135 G C 7: 89,147,978 L357V probably benign Het
Tox4 T C 14: 52,286,861 S151P probably damaging Het
Trim34b A T 7: 104,336,112 D318V probably damaging Het
Ubtd1 T C 19: 42,033,756 S156P probably damaging Het
Usp34 C A 11: 23,484,143 L3240M Het
Vmn1r56 T C 7: 5,195,806 S271G probably damaging Het
Vps13b T C 15: 35,472,066 probably benign Het
Vps13c T C 9: 67,945,828 F2401S probably damaging Het
Zbtb11 G A 16: 55,982,274 V216I probably damaging Het
Zfp931 T C 2: 178,067,796 T266A possibly damaging Het
Zfp956 A G 6: 47,956,108 M106V probably benign Het
Other mutations in Arhgap11a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Arhgap11a APN 2 113834256 missense probably benign 0.00
IGL00337:Arhgap11a APN 2 113841942 missense probably damaging 0.96
IGL00532:Arhgap11a APN 2 113834066 missense probably benign
IGL00869:Arhgap11a APN 2 113834826 missense probably damaging 0.99
IGL01123:Arhgap11a APN 2 113834773 splice site probably benign
IGL01353:Arhgap11a APN 2 113833524 missense probably damaging 1.00
IGL01725:Arhgap11a APN 2 113837552 missense probably damaging 0.98
IGL01911:Arhgap11a APN 2 113840732 missense probably damaging 1.00
IGL02077:Arhgap11a APN 2 113837471 missense possibly damaging 0.94
IGL02532:Arhgap11a APN 2 113833676 nonsense probably null
IGL02553:Arhgap11a APN 2 113837561 splice site probably benign
IGL02738:Arhgap11a APN 2 113832975 makesense probably null
IGL02945:Arhgap11a APN 2 113837473 missense possibly damaging 0.83
R0480:Arhgap11a UTSW 2 113839818 missense probably benign 0.03
R0515:Arhgap11a UTSW 2 113837471 missense possibly damaging 0.48
R0625:Arhgap11a UTSW 2 113841711 missense probably benign 0.01
R0898:Arhgap11a UTSW 2 113836876 missense probably benign 0.01
R1248:Arhgap11a UTSW 2 113834102 missense possibly damaging 0.63
R1395:Arhgap11a UTSW 2 113833122 missense probably benign 0.00
R1669:Arhgap11a UTSW 2 113841912 missense possibly damaging 0.92
R2915:Arhgap11a UTSW 2 113833508 missense probably damaging 1.00
R3941:Arhgap11a UTSW 2 113836897 missense probably damaging 1.00
R4194:Arhgap11a UTSW 2 113841994 missense probably benign 0.02
R4508:Arhgap11a UTSW 2 113842042 missense probably damaging 1.00
R4617:Arhgap11a UTSW 2 113834078 missense probably benign 0.01
R4839:Arhgap11a UTSW 2 113842029 missense probably damaging 1.00
R4842:Arhgap11a UTSW 2 113839762 missense probably damaging 0.98
R5507:Arhgap11a UTSW 2 113841678 missense probably benign
R5538:Arhgap11a UTSW 2 113837530 missense probably benign
R5660:Arhgap11a UTSW 2 113841910 missense possibly damaging 0.80
R5712:Arhgap11a UTSW 2 113845301 missense probably benign 0.09
R5849:Arhgap11a UTSW 2 113834847 missense probably null 0.01
R5856:Arhgap11a UTSW 2 113833771 missense possibly damaging 0.63
R6101:Arhgap11a UTSW 2 113834874 nonsense probably null
R6119:Arhgap11a UTSW 2 113834350 missense probably benign
R6338:Arhgap11a UTSW 2 113833725 missense probably benign 0.37
R6563:Arhgap11a UTSW 2 113833902 missense probably benign 0.00
R6919:Arhgap11a UTSW 2 113839709 missense possibly damaging 0.94
R7798:Arhgap11a UTSW 2 113843335 missense probably damaging 0.98
R7819:Arhgap11a UTSW 2 113834918 critical splice acceptor site probably null
R8208:Arhgap11a UTSW 2 113842939 missense probably benign 0.10
X0065:Arhgap11a UTSW 2 113834231 missense probably benign 0.41
Z1088:Arhgap11a UTSW 2 113842894 missense probably damaging 1.00
Z1176:Arhgap11a UTSW 2 113833758 missense probably benign 0.34
Predicted Primers PCR Primer
(F):5'- AACTGTACAGTGCTGATACTCACAC -3'
(R):5'- ATTTCGCTAGCAGGCCAGTG -3'

Sequencing Primer
(F):5'- GTGCTGATACTCACACGCATC -3'
(R):5'- CTAGCAGGCCAGTGTGTGTG -3'
Posted On2021-04-30