Incidental Mutation 'R8806:Anapc1'
ID672045
Institutional Source Beutler Lab
Gene Symbol Anapc1
Ensembl Gene ENSMUSG00000014355
Gene Nameanaphase promoting complex subunit 1
Synonyms2610021O03Rik, tsg24, Apc1, Mcpr
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8806 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location128610104-128687391 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 128622413 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 1721 (Q1721L)
Ref Sequence ENSEMBL: ENSMUSP00000014499 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014499]
Predicted Effect possibly damaging
Transcript: ENSMUST00000014499
AA Change: Q1721L

PolyPhen 2 Score 0.670 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000014499
Gene: ENSMUSG00000014355
AA Change: Q1721L

DomainStartEndE-ValueType
Pfam:ANAPC1 150 214 1.7e-13 PFAM
low complexity region 323 345 N/A INTRINSIC
low complexity region 1404 1415 N/A INTRINSIC
Pfam:PC_rep 1467 1501 8.3e-8 PFAM
low complexity region 1516 1528 N/A INTRINSIC
low complexity region 1924 1936 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the anaphase-promoting complex. This complex is an E3 ubiquitin ligase that regulates progression through the metaphase to anaphase portion of the cell cycle by ubiquitinating proteins which targets them for degradation. [provided by RefSeq, Dec 2011]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik A G 4: 42,971,261 D198G probably benign Het
Abca1 T C 4: 53,084,520 M586V probably benign Het
Adam6b G A 12: 113,491,798 R745H possibly damaging Het
Afg3l1 A G 8: 123,493,918 D462G probably damaging Het
Arhgap11a T C 2: 113,834,762 Y497C possibly damaging Het
Bcl7b T G 5: 135,179,970 S96A possibly damaging Het
Birc6 T C 17: 74,642,316 V3111A probably damaging Het
Cbx1 A G 11: 96,801,557 D90G possibly damaging Het
Ccdc105 A G 10: 78,752,472 V168A probably damaging Het
Cdkl3 T C 11: 52,032,468 F524S possibly damaging Het
Cops7b G A 1: 86,589,309 G44R probably damaging Het
D130043K22Rik A G 13: 24,899,635 S1028G probably benign Het
Decr1 T A 4: 15,945,351 M1L probably benign Het
Dmtn T C 14: 70,614,948 I167V probably benign Het
Dnah9 A G 11: 65,859,483 L3932P probably damaging Het
Ece1 T A 4: 137,945,141 I365N probably damaging Het
Exo5 T C 4: 120,922,405 T88A probably benign Het
Frem3 T C 8: 80,663,435 Y1772H probably benign Het
Gm11639 T A 11: 105,037,869 M4815K probably benign Het
Gm5160 A G 18: 14,424,874 N3D possibly damaging Het
Gm7138 T A 10: 77,776,883 D21V unknown Het
Gucy2e A G 11: 69,236,116 V177A probably benign Het
Islr C A 9: 58,156,973 G417V unknown Het
Kif13a A T 13: 46,761,337 M1458K possibly damaging Het
Mcm7 T C 5: 138,165,085 D642G possibly damaging Het
Med24 A T 11: 98,705,144 I941N probably damaging Het
Mrgprb8 C T 7: 48,389,228 P216S possibly damaging Het
Myo5c T A 9: 75,242,772 V13D probably damaging Het
N4bp2 T A 5: 65,808,208 I1200K possibly damaging Het
Naip6 G A 13: 100,300,653 T454M possibly damaging Het
Nfkb1 T C 3: 135,589,452 Y877C probably damaging Het
Nolc1 C A 19: 46,083,032 S473R unknown Het
Nop16 A C 13: 54,589,859 probably benign Het
Nr3c2 T C 8: 77,242,463 I959T probably damaging Het
Nup88 T G 11: 70,944,115 K692N probably benign Het
Nvl C A 1: 181,095,054 G818V probably benign Het
Olfr1046 T C 2: 86,216,856 I285V probably damaging Het
Olfr1193 T C 2: 88,678,611 V245A probably benign Het
Olfr1357 G T 10: 78,612,140 T167N probably benign Het
Olfr731 T A 14: 50,237,919 E322V probably benign Het
Olfr732 A G 14: 50,281,779 I158T probably benign Het
Olfr913 A T 9: 38,595,109 D296V probably damaging Het
Plxnc1 G A 10: 94,799,278 S1362L probably damaging Het
Ppfia2 C T 10: 106,858,253 A696V probably damaging Het
Prl A G 13: 27,059,532 Y62C probably damaging Het
Rnf135 A G 11: 80,198,936 D366G probably damaging Het
Rrp8 A G 7: 105,735,037 L86P probably damaging Het
Rsph4a T C 10: 33,909,449 V452A probably damaging Het
Runx2 C A 17: 44,639,683 V410L probably benign Het
Samd9l T C 6: 3,376,665 T199A probably damaging Het
Sik3 T C 9: 46,209,067 S745P probably damaging Het
Slc35e1 T A 8: 72,488,129 S250C probably damaging Het
Snx31 A G 15: 36,537,552 F160S probably damaging Het
Stim2 T A 5: 53,998,915 V11E probably benign Het
Tmem135 G C 7: 89,147,978 L357V probably benign Het
Tox4 T C 14: 52,286,861 S151P probably damaging Het
Trim34b A T 7: 104,336,112 D318V probably damaging Het
Ubtd1 T C 19: 42,033,756 S156P probably damaging Het
Usp34 C A 11: 23,484,143 L3240M Het
Vmn1r56 T C 7: 5,195,806 S271G probably damaging Het
Vps13b T C 15: 35,472,066 probably benign Het
Vps13c T C 9: 67,945,828 F2401S probably damaging Het
Zbtb11 G A 16: 55,982,274 V216I probably damaging Het
Zfp931 T C 2: 178,067,796 T266A possibly damaging Het
Zfp956 A G 6: 47,956,108 M106V probably benign Het
Other mutations in Anapc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00232:Anapc1 APN 2 128645130 splice site probably benign
IGL00704:Anapc1 APN 2 128663984 missense possibly damaging 0.48
IGL01023:Anapc1 APN 2 128629729 missense probably damaging 1.00
IGL01432:Anapc1 APN 2 128633408 missense probably damaging 1.00
IGL01549:Anapc1 APN 2 128653170 missense probably benign
IGL02089:Anapc1 APN 2 128663933 missense probably damaging 1.00
IGL02275:Anapc1 APN 2 128659852 missense probably benign
IGL02570:Anapc1 APN 2 128645200 missense probably damaging 1.00
IGL02597:Anapc1 APN 2 128623931 missense probably benign 0.02
IGL02726:Anapc1 APN 2 128659785 missense probably benign 0.05
IGL03265:Anapc1 APN 2 128627197 missense probably damaging 1.00
IGL03304:Anapc1 APN 2 128627113 splice site probably benign
IGL03327:Anapc1 APN 2 128623934 missense probably benign 0.00
R0023:Anapc1 UTSW 2 128678218 missense probably damaging 0.99
R0027:Anapc1 UTSW 2 128641511 missense possibly damaging 0.96
R0027:Anapc1 UTSW 2 128641511 missense possibly damaging 0.96
R0084:Anapc1 UTSW 2 128623966 splice site probably benign
R0103:Anapc1 UTSW 2 128680452 splice site probably benign
R0103:Anapc1 UTSW 2 128680452 splice site probably benign
R0109:Anapc1 UTSW 2 128634693 missense probably damaging 1.00
R0109:Anapc1 UTSW 2 128634693 missense probably damaging 1.00
R0241:Anapc1 UTSW 2 128628629 missense possibly damaging 0.89
R0241:Anapc1 UTSW 2 128628629 missense possibly damaging 0.89
R0255:Anapc1 UTSW 2 128634711 missense probably damaging 0.99
R0377:Anapc1 UTSW 2 128641340 critical splice donor site probably null
R0467:Anapc1 UTSW 2 128669043 missense probably damaging 0.99
R0514:Anapc1 UTSW 2 128632655 missense probably damaging 0.99
R0591:Anapc1 UTSW 2 128619332 missense probably benign 0.17
R0919:Anapc1 UTSW 2 128617731 missense probably benign
R1175:Anapc1 UTSW 2 128680188 missense probably damaging 1.00
R1473:Anapc1 UTSW 2 128617697 missense possibly damaging 0.88
R1547:Anapc1 UTSW 2 128617556 missense probably benign 0.44
R1556:Anapc1 UTSW 2 128624899 missense probably benign 0.00
R1567:Anapc1 UTSW 2 128617716 missense probably damaging 1.00
R1635:Anapc1 UTSW 2 128628532 missense probably damaging 1.00
R1645:Anapc1 UTSW 2 128658246 critical splice donor site probably null
R1677:Anapc1 UTSW 2 128676208 missense probably benign 0.09
R1854:Anapc1 UTSW 2 128675890 missense probably damaging 1.00
R1856:Anapc1 UTSW 2 128659788 missense probably damaging 0.96
R1959:Anapc1 UTSW 2 128633415 missense probably benign 0.36
R1984:Anapc1 UTSW 2 128669688 missense possibly damaging 0.85
R2034:Anapc1 UTSW 2 128648458 missense possibly damaging 0.92
R2283:Anapc1 UTSW 2 128642548 missense probably benign 0.23
R2928:Anapc1 UTSW 2 128680137 missense probably damaging 1.00
R3547:Anapc1 UTSW 2 128642682 missense possibly damaging 0.58
R3904:Anapc1 UTSW 2 128642519 missense probably damaging 1.00
R4156:Anapc1 UTSW 2 128627229 intron probably benign
R4359:Anapc1 UTSW 2 128623556 missense possibly damaging 0.64
R4392:Anapc1 UTSW 2 128676249 critical splice acceptor site probably null
R4574:Anapc1 UTSW 2 128627195 missense probably damaging 1.00
R4682:Anapc1 UTSW 2 128664005 missense probably benign 0.05
R4770:Anapc1 UTSW 2 128686060 splice site probably benign
R4824:Anapc1 UTSW 2 128628690 missense possibly damaging 0.69
R4960:Anapc1 UTSW 2 128684594 missense probably benign 0.23
R5016:Anapc1 UTSW 2 128607175 unclassified probably benign
R5063:Anapc1 UTSW 2 128629549 missense possibly damaging 0.48
R5128:Anapc1 UTSW 2 128659917 missense probably benign
R5271:Anapc1 UTSW 2 128685985 nonsense probably null
R5363:Anapc1 UTSW 2 128650194 critical splice donor site probably null
R5469:Anapc1 UTSW 2 128675701 nonsense probably null
R5473:Anapc1 UTSW 2 128607195 unclassified probably benign
R5559:Anapc1 UTSW 2 128680434 nonsense probably null
R5631:Anapc1 UTSW 2 128657217 missense possibly damaging 0.85
R5747:Anapc1 UTSW 2 128624916 missense probably benign 0.19
R5840:Anapc1 UTSW 2 128607037 unclassified probably benign
R6226:Anapc1 UTSW 2 128650372 missense probably damaging 1.00
R6526:Anapc1 UTSW 2 128672135 nonsense probably null
R6561:Anapc1 UTSW 2 128663999 missense probably damaging 0.98
R6743:Anapc1 UTSW 2 128684534 nonsense probably null
R6799:Anapc1 UTSW 2 128659737 missense probably null 0.38
R6887:Anapc1 UTSW 2 128659768 missense possibly damaging 0.91
R6978:Anapc1 UTSW 2 128669900 missense probably benign 0.06
R7011:Anapc1 UTSW 2 128648681 splice site probably null
R7041:Anapc1 UTSW 2 128628656 missense possibly damaging 0.88
R7047:Anapc1 UTSW 2 128615430 missense probably damaging 0.96
R7074:Anapc1 UTSW 2 128678274 missense probably damaging 1.00
R7109:Anapc1 UTSW 2 128674602 missense probably benign 0.33
R7123:Anapc1 UTSW 2 128613010 missense probably damaging 1.00
R7309:Anapc1 UTSW 2 128674684 missense probably damaging 0.96
R7693:Anapc1 UTSW 2 128641537 missense possibly damaging 0.86
R7839:Anapc1 UTSW 2 128684608 missense probably damaging 0.99
R7847:Anapc1 UTSW 2 128669908 missense possibly damaging 0.93
R7960:Anapc1 UTSW 2 128674593 missense probably damaging 1.00
R8061:Anapc1 UTSW 2 128648488 missense probably damaging 0.98
R8127:Anapc1 UTSW 2 128632627 missense probably damaging 0.96
R8228:Anapc1 UTSW 2 128619917 nonsense probably null
R8402:Anapc1 UTSW 2 128630228 missense probably benign 0.02
R8422:Anapc1 UTSW 2 128675837 missense probably benign
R8425:Anapc1 UTSW 2 128669868 missense probably damaging 1.00
R8469:Anapc1 UTSW 2 128658344 splice site probably null
R8553:Anapc1 UTSW 2 128619913 missense possibly damaging 0.80
R8688:Anapc1 UTSW 2 128685828 missense probably benign 0.19
R8699:Anapc1 UTSW 2 128641453 missense probably damaging 1.00
R8719:Anapc1 UTSW 2 128641449 missense probably damaging 1.00
R8775:Anapc1 UTSW 2 128657173 missense possibly damaging 0.92
R8775-TAIL:Anapc1 UTSW 2 128657173 missense possibly damaging 0.92
X0066:Anapc1 UTSW 2 128674701 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- TTACACAGAATACTAGCATGCCATC -3'
(R):5'- TGGAAAACACCAAGTTCAGCAG -3'

Sequencing Primer
(F):5'- TCACTTTGTAGACCAGGCAG -3'
(R):5'- GCAGAGAATTATTAATAATACCGCCC -3'
Posted On2021-04-30