Incidental Mutation 'R8806:Abca1'
ID672050
Institutional Source Beutler Lab
Gene Symbol Abca1
Ensembl Gene ENSMUSG00000015243
Gene NameATP-binding cassette, sub-family A (ABC1), member 1
SynonymsABC1
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8806 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location53030787-53159895 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 53084520 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 586 (M586V)
Ref Sequence ENSEMBL: ENSMUSP00000030010 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030010]
Predicted Effect probably benign
Transcript: ENSMUST00000030010
AA Change: M586V

PolyPhen 2 Score 0.173 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000030010
Gene: ENSMUSG00000015243
AA Change: M586V

DomainStartEndE-ValueType
transmembrane domain 25 47 N/A INTRINSIC
Pfam:ABC2_membrane_3 395 841 4.9e-14 PFAM
AAA 925 1122 4.2e-10 SMART
low complexity region 1137 1150 N/A INTRINSIC
Pfam:ABC2_membrane_3 1344 1869 1.7e-53 PFAM
low complexity region 1890 1899 N/A INTRINSIC
AAA 1938 2123 3.04e-7 SMART
low complexity region 2176 2187 N/A INTRINSIC
low complexity region 2222 2237 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype FUNCTION: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the ABC1 subfamily. Members of the ABC1 subfamily comprise the only major ABC subfamily found exclusively in multicellular eukaryotes. In humans, this protein functions as a cholesterol efflux pump in the cellular lipid removal pathway. Mutations in the human gene have been associated with Tangier's disease and familial high-density lipoprotein deficiency. [provided by RefSeq, Jul 2008]
PHENOTYPE: Many homozygous null mutants die perinatally with placental defects. Survivors show altered steroidogenesis, defective lipid export in Golgi, low serum cholesterol, lipid accumulation in macrophages and lung, reduced fertility and kidney and heart defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik A G 4: 42,971,261 D198G probably benign Het
Adam6b G A 12: 113,491,798 R745H possibly damaging Het
Afg3l1 A G 8: 123,493,918 D462G probably damaging Het
Anapc1 T A 2: 128,622,413 Q1721L possibly damaging Het
Arhgap11a T C 2: 113,834,762 Y497C possibly damaging Het
Bcl7b T G 5: 135,179,970 S96A possibly damaging Het
Birc6 T C 17: 74,642,316 V3111A probably damaging Het
Cbx1 A G 11: 96,801,557 D90G possibly damaging Het
Ccdc105 A G 10: 78,752,472 V168A probably damaging Het
Cdkl3 T C 11: 52,032,468 F524S possibly damaging Het
Cops7b G A 1: 86,589,309 G44R probably damaging Het
D130043K22Rik A G 13: 24,899,635 S1028G probably benign Het
Decr1 T A 4: 15,945,351 M1L probably benign Het
Dmtn T C 14: 70,614,948 I167V probably benign Het
Dnah9 A G 11: 65,859,483 L3932P probably damaging Het
Ece1 T A 4: 137,945,141 I365N probably damaging Het
Exo5 T C 4: 120,922,405 T88A probably benign Het
Frem3 T C 8: 80,663,435 Y1772H probably benign Het
Gm11639 T A 11: 105,037,869 M4815K probably benign Het
Gm5160 A G 18: 14,424,874 N3D possibly damaging Het
Gm7138 T A 10: 77,776,883 D21V unknown Het
Gucy2e A G 11: 69,236,116 V177A probably benign Het
Islr C A 9: 58,156,973 G417V unknown Het
Kif13a A T 13: 46,761,337 M1458K possibly damaging Het
Mcm7 T C 5: 138,165,085 D642G possibly damaging Het
Med24 A T 11: 98,705,144 I941N probably damaging Het
Mrgprb8 C T 7: 48,389,228 P216S possibly damaging Het
Myo5c T A 9: 75,242,772 V13D probably damaging Het
N4bp2 T A 5: 65,808,208 I1200K possibly damaging Het
Naip6 G A 13: 100,300,653 T454M possibly damaging Het
Nfkb1 T C 3: 135,589,452 Y877C probably damaging Het
Nolc1 C A 19: 46,083,032 S473R unknown Het
Nop16 A C 13: 54,589,859 probably benign Het
Nr3c2 T C 8: 77,242,463 I959T probably damaging Het
Nup88 T G 11: 70,944,115 K692N probably benign Het
Nvl C A 1: 181,095,054 G818V probably benign Het
Olfr1046 T C 2: 86,216,856 I285V probably damaging Het
Olfr1193 T C 2: 88,678,611 V245A probably benign Het
Olfr1357 G T 10: 78,612,140 T167N probably benign Het
Olfr731 T A 14: 50,237,919 E322V probably benign Het
Olfr732 A G 14: 50,281,779 I158T probably benign Het
Olfr913 A T 9: 38,595,109 D296V probably damaging Het
Plxnc1 G A 10: 94,799,278 S1362L probably damaging Het
Ppfia2 C T 10: 106,858,253 A696V probably damaging Het
Prl A G 13: 27,059,532 Y62C probably damaging Het
Rnf135 A G 11: 80,198,936 D366G probably damaging Het
Rrp8 A G 7: 105,735,037 L86P probably damaging Het
Rsph4a T C 10: 33,909,449 V452A probably damaging Het
Runx2 C A 17: 44,639,683 V410L probably benign Het
Samd9l T C 6: 3,376,665 T199A probably damaging Het
Sik3 T C 9: 46,209,067 S745P probably damaging Het
Slc35e1 T A 8: 72,488,129 S250C probably damaging Het
Snx31 A G 15: 36,537,552 F160S probably damaging Het
Stim2 T A 5: 53,998,915 V11E probably benign Het
Tmem135 G C 7: 89,147,978 L357V probably benign Het
Tox4 T C 14: 52,286,861 S151P probably damaging Het
Trim34b A T 7: 104,336,112 D318V probably damaging Het
Ubtd1 T C 19: 42,033,756 S156P probably damaging Het
Usp34 C A 11: 23,484,143 L3240M Het
Vmn1r56 T C 7: 5,195,806 S271G probably damaging Het
Vps13b T C 15: 35,472,066 probably benign Het
Vps13c T C 9: 67,945,828 F2401S probably damaging Het
Zbtb11 G A 16: 55,982,274 V216I probably damaging Het
Zfp931 T C 2: 178,067,796 T266A possibly damaging Het
Zfp956 A G 6: 47,956,108 M106V probably benign Het
Other mutations in Abca1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Abca1 APN 4 53059255 critical splice donor site probably null
IGL00778:Abca1 APN 4 53086132 missense probably benign
IGL01013:Abca1 APN 4 53038185 nonsense probably null
IGL01510:Abca1 APN 4 53143979 missense probably damaging 0.97
IGL01608:Abca1 APN 4 53038158 missense probably damaging 1.00
IGL01845:Abca1 APN 4 53090297 missense probably damaging 1.00
IGL02048:Abca1 APN 4 53069831 missense probably damaging 1.00
IGL02249:Abca1 APN 4 53068739 nonsense probably null
IGL02569:Abca1 APN 4 53034061 missense probably damaging 1.00
IGL02622:Abca1 APN 4 53034046 missense probably damaging 0.99
R6720_abca1_529 UTSW 4 53083733 missense probably damaging 1.00
R0042:Abca1 UTSW 4 53059245 splice site probably benign
R0042:Abca1 UTSW 4 53059245 splice site probably benign
R0050:Abca1 UTSW 4 53069910 splice site probably benign
R0107:Abca1 UTSW 4 53080834 missense probably benign 0.00
R0127:Abca1 UTSW 4 53067155 missense probably benign 0.00
R0178:Abca1 UTSW 4 53081953 missense possibly damaging 0.89
R0207:Abca1 UTSW 4 53086039 missense probably damaging 0.97
R0267:Abca1 UTSW 4 53046105 missense probably damaging 1.00
R0269:Abca1 UTSW 4 53044228 missense probably benign
R0586:Abca1 UTSW 4 53092860 missense probably benign 0.00
R0587:Abca1 UTSW 4 53107035 missense probably benign 0.00
R1403:Abca1 UTSW 4 53059253 splice site probably benign
R1404:Abca1 UTSW 4 53059253 splice site probably benign
R1405:Abca1 UTSW 4 53059253 splice site probably benign
R1558:Abca1 UTSW 4 53092887 missense probably null 0.00
R1655:Abca1 UTSW 4 53050964 missense probably benign
R1662:Abca1 UTSW 4 53090251 splice site probably null
R1769:Abca1 UTSW 4 53074325 missense probably damaging 1.00
R1898:Abca1 UTSW 4 53071977 missense probably benign 0.08
R1945:Abca1 UTSW 4 53061509 frame shift probably null
R1966:Abca1 UTSW 4 53050409 missense probably damaging 1.00
R2055:Abca1 UTSW 4 53069881 missense probably benign
R2185:Abca1 UTSW 4 53089830 missense probably benign 0.12
R2202:Abca1 UTSW 4 53090291 missense probably damaging 0.96
R2203:Abca1 UTSW 4 53090291 missense probably damaging 0.96
R2204:Abca1 UTSW 4 53090291 missense probably damaging 0.96
R3056:Abca1 UTSW 4 53127626 missense probably benign
R3849:Abca1 UTSW 4 53061481 splice site probably benign
R3850:Abca1 UTSW 4 53061481 splice site probably benign
R3906:Abca1 UTSW 4 53067151 missense possibly damaging 0.84
R3908:Abca1 UTSW 4 53067151 missense possibly damaging 0.84
R4050:Abca1 UTSW 4 53044144 missense probably damaging 1.00
R4204:Abca1 UTSW 4 53090369 missense probably benign 0.00
R4225:Abca1 UTSW 4 53085106 missense possibly damaging 0.87
R4577:Abca1 UTSW 4 53062568 missense possibly damaging 0.94
R4979:Abca1 UTSW 4 53085092 splice site probably null
R5022:Abca1 UTSW 4 53041570 frame shift probably null
R5168:Abca1 UTSW 4 53086070 missense probably benign
R5363:Abca1 UTSW 4 53132963 missense probably benign 0.00
R5439:Abca1 UTSW 4 53042381 missense possibly damaging 0.55
R5604:Abca1 UTSW 4 53067168 splice site probably null
R5614:Abca1 UTSW 4 53046132 missense probably damaging 1.00
R5810:Abca1 UTSW 4 53079631 missense probably benign
R6001:Abca1 UTSW 4 53075555 missense possibly damaging 0.68
R6151:Abca1 UTSW 4 53085261 missense probably benign
R6185:Abca1 UTSW 4 53078089 missense probably benign 0.31
R6262:Abca1 UTSW 4 53092917 missense probably benign 0.01
R6455:Abca1 UTSW 4 53042376 missense probably damaging 0.98
R6472:Abca1 UTSW 4 53085991 critical splice donor site probably null
R6564:Abca1 UTSW 4 53034031 missense possibly damaging 0.85
R6720:Abca1 UTSW 4 53083733 missense probably damaging 1.00
R6903:Abca1 UTSW 4 53143952 missense probably benign 0.17
R6960:Abca1 UTSW 4 53072924 missense probably benign 0.00
R7065:Abca1 UTSW 4 53074233 missense probably damaging 0.98
R7142:Abca1 UTSW 4 53082050 missense probably damaging 1.00
R7322:Abca1 UTSW 4 53067151 missense probably damaging 0.97
R7520:Abca1 UTSW 4 53078114 missense probably benign
R7547:Abca1 UTSW 4 53109269 missense probably benign 0.02
R7793:Abca1 UTSW 4 53042367 missense not run
R7863:Abca1 UTSW 4 53107179 missense probably benign
R7877:Abca1 UTSW 4 53046135 missense possibly damaging 0.55
R8010:Abca1 UTSW 4 53127600 missense probably benign
R8058:Abca1 UTSW 4 53081954 missense possibly damaging 0.60
R8181:Abca1 UTSW 4 53059303 missense probably benign 0.21
R8471:Abca1 UTSW 4 53044187 missense probably damaging 1.00
R8774:Abca1 UTSW 4 53090358 missense possibly damaging 0.89
R8774-TAIL:Abca1 UTSW 4 53090358 missense possibly damaging 0.89
RF005:Abca1 UTSW 4 53049125 missense probably damaging 0.97
RF024:Abca1 UTSW 4 53049125 missense probably damaging 0.97
X0023:Abca1 UTSW 4 53049038 missense possibly damaging 0.91
Z1177:Abca1 UTSW 4 53079584 missense probably benign 0.00
Z1177:Abca1 UTSW 4 53080799 missense probably benign 0.01
Z1177:Abca1 UTSW 4 53086133 missense possibly damaging 0.73
Predicted Primers PCR Primer
(F):5'- ACCTGGTTATCTAAGGGAGATGTTG -3'
(R):5'- CCCAGAAGGAGTGTTTTCATTG -3'

Sequencing Primer
(F):5'- GGCTTGTTGGTACACTCACATGTC -3'
(R):5'- CCAAGAATTTATGTACTTGTCAGCTG -3'
Posted On2021-04-30