Incidental Mutation 'R8806:Bcl7b'
ID672055
Institutional Source Beutler Lab
Gene Symbol Bcl7b
Ensembl Gene ENSMUSG00000029681
Gene NameB cell CLL/lymphoma 7B
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8806 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location135168283-135181855 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 135179970 bp
ZygosityHeterozygous
Amino Acid Change Serine to Alanine at position 96 (S96A)
Ref Sequence ENSEMBL: ENSMUSP00000031692 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031692] [ENSMUST00000111188] [ENSMUST00000202606]
Predicted Effect possibly damaging
Transcript: ENSMUST00000031692
AA Change: S96A

PolyPhen 2 Score 0.898 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000031692
Gene: ENSMUSG00000029681
AA Change: S96A

DomainStartEndE-ValueType
Pfam:BCL_N 3 51 1.5e-31 PFAM
low complexity region 54 62 N/A INTRINSIC
low complexity region 107 123 N/A INTRINSIC
low complexity region 164 178 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111188
SMART Domains Protein: ENSMUSP00000106819
Gene: ENSMUSG00000029681

DomainStartEndE-ValueType
Pfam:BCL_N 2 53 5.2e-32 PFAM
low complexity region 54 62 N/A INTRINSIC
low complexity region 107 121 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000202606
AA Change: S70A

PolyPhen 2 Score 0.909 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000144538
Gene: ENSMUSG00000029681
AA Change: S70A

DomainStartEndE-ValueType
Pfam:BCL_N 2 25 3.8e-11 PFAM
low complexity region 28 36 N/A INTRINSIC
low complexity region 81 97 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the BCL7 family including BCL7A, BCL7B and BCL7C proteins. This member is BCL7B, which contains a region that is highly similar to the N-terminal segment of BCL7A or BCL7C proteins. The BCL7A protein is encoded by the gene known to be directly involved in a three-way gene translocation in a Burkitt lymphoma cell line. This gene is located at a chromosomal region commonly deleted in Williams syndrome. This gene is highly conserved from C. elegans to human. Multiple alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Oct 2010]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik A G 4: 42,971,261 D198G probably benign Het
Abca1 T C 4: 53,084,520 M586V probably benign Het
Adam6b G A 12: 113,491,798 R745H possibly damaging Het
Afg3l1 A G 8: 123,493,918 D462G probably damaging Het
Anapc1 T A 2: 128,622,413 Q1721L possibly damaging Het
Arhgap11a T C 2: 113,834,762 Y497C possibly damaging Het
Birc6 T C 17: 74,642,316 V3111A probably damaging Het
Cbx1 A G 11: 96,801,557 D90G possibly damaging Het
Ccdc105 A G 10: 78,752,472 V168A probably damaging Het
Cdkl3 T C 11: 52,032,468 F524S possibly damaging Het
Cops7b G A 1: 86,589,309 G44R probably damaging Het
D130043K22Rik A G 13: 24,899,635 S1028G probably benign Het
Decr1 T A 4: 15,945,351 M1L probably benign Het
Dmtn T C 14: 70,614,948 I167V probably benign Het
Dnah9 A G 11: 65,859,483 L3932P probably damaging Het
Ece1 T A 4: 137,945,141 I365N probably damaging Het
Exo5 T C 4: 120,922,405 T88A probably benign Het
Frem3 T C 8: 80,663,435 Y1772H probably benign Het
Gm11639 T A 11: 105,037,869 M4815K probably benign Het
Gm5160 A G 18: 14,424,874 N3D possibly damaging Het
Gm7138 T A 10: 77,776,883 D21V unknown Het
Gucy2e A G 11: 69,236,116 V177A probably benign Het
Islr C A 9: 58,156,973 G417V unknown Het
Kif13a A T 13: 46,761,337 M1458K possibly damaging Het
Mcm7 T C 5: 138,165,085 D642G possibly damaging Het
Med24 A T 11: 98,705,144 I941N probably damaging Het
Mrgprb8 C T 7: 48,389,228 P216S possibly damaging Het
Myo5c T A 9: 75,242,772 V13D probably damaging Het
N4bp2 T A 5: 65,808,208 I1200K possibly damaging Het
Naip6 G A 13: 100,300,653 T454M possibly damaging Het
Nfkb1 T C 3: 135,589,452 Y877C probably damaging Het
Nolc1 C A 19: 46,083,032 S473R unknown Het
Nop16 A C 13: 54,589,859 probably benign Het
Nr3c2 T C 8: 77,242,463 I959T probably damaging Het
Nup88 T G 11: 70,944,115 K692N probably benign Het
Nvl C A 1: 181,095,054 G818V probably benign Het
Olfr1046 T C 2: 86,216,856 I285V probably damaging Het
Olfr1193 T C 2: 88,678,611 V245A probably benign Het
Olfr1357 G T 10: 78,612,140 T167N probably benign Het
Olfr731 T A 14: 50,237,919 E322V probably benign Het
Olfr732 A G 14: 50,281,779 I158T probably benign Het
Olfr913 A T 9: 38,595,109 D296V probably damaging Het
Plxnc1 G A 10: 94,799,278 S1362L probably damaging Het
Ppfia2 C T 10: 106,858,253 A696V probably damaging Het
Prl A G 13: 27,059,532 Y62C probably damaging Het
Rnf135 A G 11: 80,198,936 D366G probably damaging Het
Rrp8 A G 7: 105,735,037 L86P probably damaging Het
Rsph4a T C 10: 33,909,449 V452A probably damaging Het
Runx2 C A 17: 44,639,683 V410L probably benign Het
Samd9l T C 6: 3,376,665 T199A probably damaging Het
Sik3 T C 9: 46,209,067 S745P probably damaging Het
Slc35e1 T A 8: 72,488,129 S250C probably damaging Het
Snx31 A G 15: 36,537,552 F160S probably damaging Het
Stim2 T A 5: 53,998,915 V11E probably benign Het
Tmem135 G C 7: 89,147,978 L357V probably benign Het
Tox4 T C 14: 52,286,861 S151P probably damaging Het
Trim34b A T 7: 104,336,112 D318V probably damaging Het
Ubtd1 T C 19: 42,033,756 S156P probably damaging Het
Usp34 C A 11: 23,484,143 L3240M Het
Vmn1r56 T C 7: 5,195,806 S271G probably damaging Het
Vps13b T C 15: 35,472,066 probably benign Het
Vps13c T C 9: 67,945,828 F2401S probably damaging Het
Zbtb11 G A 16: 55,982,274 V216I probably damaging Het
Zfp931 T C 2: 178,067,796 T266A possibly damaging Het
Zfp956 A G 6: 47,956,108 M106V probably benign Het
Other mutations in Bcl7b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01367:Bcl7b APN 5 135180096 missense probably damaging 1.00
R0468:Bcl7b UTSW 5 135180883 missense probably benign 0.18
R3732:Bcl7b UTSW 5 135180913 missense probably benign 0.00
R3732:Bcl7b UTSW 5 135180913 missense probably benign 0.00
R3733:Bcl7b UTSW 5 135180913 missense probably benign 0.00
R4857:Bcl7b UTSW 5 135173179 makesense probably null
R5020:Bcl7b UTSW 5 135171163 critical splice donor site probably null
R6347:Bcl7b UTSW 5 135180533 missense possibly damaging 0.90
R6391:Bcl7b UTSW 5 135180025 missense probably damaging 1.00
R7791:Bcl7b UTSW 5 135171114 missense probably damaging 0.99
R7879:Bcl7b UTSW 5 135177132 missense possibly damaging 0.84
R8387:Bcl7b UTSW 5 135168559 missense probably damaging 1.00
R8408:Bcl7b UTSW 5 135168454 start gained probably benign
Predicted Primers PCR Primer
(F):5'- CATAGGTTTTGGCTGCATGTTCTATA -3'
(R):5'- GGCACCTCCATGACTCACC -3'

Sequencing Primer
(F):5'- CTAGCCTGGTCTATAGAGTGACAC -3'
(R):5'- TGACTCACCCTCCAGGATC -3'
Posted On2021-04-30