Incidental Mutation 'R8806:Mcm7'
ID672056
Institutional Source Beutler Lab
Gene Symbol Mcm7
Ensembl Gene ENSMUSG00000029730
Gene Nameminichromosome maintenance complex component 7
SynonymsMcmd7, mCDC47
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8806 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location138164583-138172422 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 138165085 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 642 (D642G)
Ref Sequence ENSEMBL: ENSMUSP00000000505 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000505] [ENSMUST00000019638] [ENSMUST00000110951] [ENSMUST00000132639] [ENSMUST00000139983] [ENSMUST00000147920] [ENSMUST00000148094] [ENSMUST00000148879] [ENSMUST00000153867] [ENSMUST00000155902]
Predicted Effect possibly damaging
Transcript: ENSMUST00000000505
AA Change: D642G

PolyPhen 2 Score 0.810 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000000505
Gene: ENSMUSG00000029730
AA Change: D642G

DomainStartEndE-ValueType
Blast:MCM 48 132 1e-41 BLAST
MCM 145 642 N/A SMART
AAA 373 526 2.9e-4 SMART
Blast:MCM 658 719 1e-32 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000019638
SMART Domains Protein: ENSMUSP00000019638
Gene: ENSMUSG00000019494

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
JAB_MPN 37 170 9.73e-35 SMART
Pfam:MitMem_reg 191 304 1.1e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110951
SMART Domains Protein: ENSMUSP00000106576
Gene: ENSMUSG00000019494

DomainStartEndE-ValueType
JAB_MPN 10 143 9.73e-35 SMART
Pfam:MitMem_reg 163 279 2.6e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000132639
SMART Domains Protein: ENSMUSP00000121554
Gene: ENSMUSG00000019494

DomainStartEndE-ValueType
Pfam:MitMem_reg 17 112 3.6e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000139983
SMART Domains Protein: ENSMUSP00000121446
Gene: ENSMUSG00000029730

DomainStartEndE-ValueType
Pfam:MCM_N 1 58 5.3e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147920
Predicted Effect probably benign
Transcript: ENSMUST00000148094
SMART Domains Protein: ENSMUSP00000121344
Gene: ENSMUSG00000029730

DomainStartEndE-ValueType
Blast:MCM 1 25 4e-7 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000148879
SMART Domains Protein: ENSMUSP00000116131
Gene: ENSMUSG00000029730

DomainStartEndE-ValueType
Blast:MCM 48 132 6e-44 BLAST
MCM 145 389 1.77e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000153867
SMART Domains Protein: ENSMUSP00000121566
Gene: ENSMUSG00000029730

DomainStartEndE-ValueType
Pfam:MCM_N 1 58 9.5e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155902
SMART Domains Protein: ENSMUSP00000120243
Gene: ENSMUSG00000029730

DomainStartEndE-ValueType
Pfam:MCM_N 1 58 5.3e-10 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is one of the highly conserved mini-chromosome maintenance proteins (MCM) that are essential for the initiation of eukaryotic genome replication. The hexameric protein complex formed by the MCM proteins is a key component of the pre-replication complex (pre_RC) and may be involved in the formation of replication forks and in the recruitment of other DNA replication related proteins. The MCM complex consisting of this protein and MCM2, 4 and 6 proteins possesses DNA helicase activity, and may act as a DNA unwinding enzyme. Cyclin D1-dependent kinase, CDK4, is found to associate with this protein, and may regulate the binding of this protein with the tumorsuppressor protein RB1/RB. Alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit prenatal lethality. Mice heterozygous for this allele exhibit increased micronulei-containing red blood cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik A G 4: 42,971,261 D198G probably benign Het
Abca1 T C 4: 53,084,520 M586V probably benign Het
Adam6b G A 12: 113,491,798 R745H possibly damaging Het
Afg3l1 A G 8: 123,493,918 D462G probably damaging Het
Anapc1 T A 2: 128,622,413 Q1721L possibly damaging Het
Arhgap11a T C 2: 113,834,762 Y497C possibly damaging Het
Bcl7b T G 5: 135,179,970 S96A possibly damaging Het
Birc6 T C 17: 74,642,316 V3111A probably damaging Het
Cbx1 A G 11: 96,801,557 D90G possibly damaging Het
Ccdc105 A G 10: 78,752,472 V168A probably damaging Het
Cdkl3 T C 11: 52,032,468 F524S possibly damaging Het
Cops7b G A 1: 86,589,309 G44R probably damaging Het
D130043K22Rik A G 13: 24,899,635 S1028G probably benign Het
Decr1 T A 4: 15,945,351 M1L probably benign Het
Dmtn T C 14: 70,614,948 I167V probably benign Het
Dnah9 A G 11: 65,859,483 L3932P probably damaging Het
Ece1 T A 4: 137,945,141 I365N probably damaging Het
Exo5 T C 4: 120,922,405 T88A probably benign Het
Frem3 T C 8: 80,663,435 Y1772H probably benign Het
Gm11639 T A 11: 105,037,869 M4815K probably benign Het
Gm5160 A G 18: 14,424,874 N3D possibly damaging Het
Gm7138 T A 10: 77,776,883 D21V unknown Het
Gucy2e A G 11: 69,236,116 V177A probably benign Het
Islr C A 9: 58,156,973 G417V unknown Het
Kif13a A T 13: 46,761,337 M1458K possibly damaging Het
Med24 A T 11: 98,705,144 I941N probably damaging Het
Mrgprb8 C T 7: 48,389,228 P216S possibly damaging Het
Myo5c T A 9: 75,242,772 V13D probably damaging Het
N4bp2 T A 5: 65,808,208 I1200K possibly damaging Het
Naip6 G A 13: 100,300,653 T454M possibly damaging Het
Nfkb1 T C 3: 135,589,452 Y877C probably damaging Het
Nolc1 C A 19: 46,083,032 S473R unknown Het
Nop16 A C 13: 54,589,859 probably benign Het
Nr3c2 T C 8: 77,242,463 I959T probably damaging Het
Nup88 T G 11: 70,944,115 K692N probably benign Het
Nvl C A 1: 181,095,054 G818V probably benign Het
Olfr1046 T C 2: 86,216,856 I285V probably damaging Het
Olfr1193 T C 2: 88,678,611 V245A probably benign Het
Olfr1357 G T 10: 78,612,140 T167N probably benign Het
Olfr731 T A 14: 50,237,919 E322V probably benign Het
Olfr732 A G 14: 50,281,779 I158T probably benign Het
Olfr913 A T 9: 38,595,109 D296V probably damaging Het
Plxnc1 G A 10: 94,799,278 S1362L probably damaging Het
Ppfia2 C T 10: 106,858,253 A696V probably damaging Het
Prl A G 13: 27,059,532 Y62C probably damaging Het
Rnf135 A G 11: 80,198,936 D366G probably damaging Het
Rrp8 A G 7: 105,735,037 L86P probably damaging Het
Rsph4a T C 10: 33,909,449 V452A probably damaging Het
Runx2 C A 17: 44,639,683 V410L probably benign Het
Samd9l T C 6: 3,376,665 T199A probably damaging Het
Sik3 T C 9: 46,209,067 S745P probably damaging Het
Slc35e1 T A 8: 72,488,129 S250C probably damaging Het
Snx31 A G 15: 36,537,552 F160S probably damaging Het
Stim2 T A 5: 53,998,915 V11E probably benign Het
Tmem135 G C 7: 89,147,978 L357V probably benign Het
Tox4 T C 14: 52,286,861 S151P probably damaging Het
Trim34b A T 7: 104,336,112 D318V probably damaging Het
Ubtd1 T C 19: 42,033,756 S156P probably damaging Het
Usp34 C A 11: 23,484,143 L3240M Het
Vmn1r56 T C 7: 5,195,806 S271G probably damaging Het
Vps13b T C 15: 35,472,066 probably benign Het
Vps13c T C 9: 67,945,828 F2401S probably damaging Het
Zbtb11 G A 16: 55,982,274 V216I probably damaging Het
Zfp931 T C 2: 178,067,796 T266A possibly damaging Het
Zfp956 A G 6: 47,956,108 M106V probably benign Het
Other mutations in Mcm7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01649:Mcm7 APN 5 138169436 missense probably damaging 1.00
IGL01954:Mcm7 APN 5 138167245 missense probably damaging 1.00
IGL02611:Mcm7 APN 5 138167439 missense probably damaging 1.00
ANU23:Mcm7 UTSW 5 138170391 missense probably benign 0.02
PIT1430001:Mcm7 UTSW 5 138167446 unclassified probably benign
R0022:Mcm7 UTSW 5 138164719 makesense probably null
R1306:Mcm7 UTSW 5 138167203 missense probably damaging 1.00
R1865:Mcm7 UTSW 5 138170375 missense possibly damaging 0.47
R2132:Mcm7 UTSW 5 138169102 missense probably damaging 1.00
R3719:Mcm7 UTSW 5 138166714 nonsense probably null
R3781:Mcm7 UTSW 5 138164736 missense probably damaging 0.99
R3782:Mcm7 UTSW 5 138164736 missense probably damaging 0.99
R4724:Mcm7 UTSW 5 138169125 missense probably damaging 1.00
R4882:Mcm7 UTSW 5 138165911 splice site probably null
R5012:Mcm7 UTSW 5 138169347 critical splice donor site probably null
R5517:Mcm7 UTSW 5 138164871 missense possibly damaging 0.92
R5718:Mcm7 UTSW 5 138164819 missense possibly damaging 0.95
R7604:Mcm7 UTSW 5 138169724 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CACCAATTCACGGATGGTGG -3'
(R):5'- TGTTCAATGAGTAGGCAAATGTGG -3'

Sequencing Primer
(F):5'- GTGGCAAATATCACATCTGCTGGC -3'
(R):5'- AAATGTGGCTTGCCCAGG -3'
Posted On2021-04-30