Mutagenetix > Incidental Mutation

Incidental Mutation 'R8806:Samd9l'

672057

Institutional Source

Beutler Lab

Gene Symbol

Samd9l

Ensembl Gene

ENSMUSG00000047735

Gene Name

sterile alpha motif domain containing 9-like

Synonyms

ESTM25

MMRRC Submission

068612-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8806 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

3372257-3399572 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 3376665 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 199 (T199A)

Ref Sequence

ENSEMBL: ENSMUSP00000112688 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000120087] [ENSMUST00000201638]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000120087
AA Change: T199A

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000112688
Gene: ENSMUSG00000047735
AA Change: T199A

Domain	Start	End	E-Value	Type
SCOP:d1kw4a_	8	75	4e-8	SMART
Blast:SAM	11	75	1e-30	BLAST
low complexity region	96	115	N/A	INTRINSIC
low complexity region	385	397	N/A	INTRINSIC
low complexity region	530	541	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000201638

SMART Domains

Protein: ENSMUSP00000144632
Gene: ENSMUSG00000047735

Domain	Start	End	E-Value	Type
Pfam:Ste50p-SAM	10	80	1.2e-8	PFAM
Pfam:SAM_2	11	68	8.7e-6	PFAM
Pfam:SAM_1	12	71	2.5e-7	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.4%

Validation Efficiency

100% (66/66)

MGI Phenotype

PHENOTYPE: Mice that are either heterozygous or homozygous for a reporter allele develop myeloid diseases and acute myelogenous leukemia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700022I11Rik	A	G	4: 42,971,261	D198G	probably benign	Het
Abca1	T	C	4: 53,084,520	M586V	probably benign	Het
Adam6b	G	A	12: 113,491,798	R745H	possibly damaging	Het
Afg3l1	A	G	8: 123,493,918	D462G	probably damaging	Het
Anapc1	T	A	2: 128,622,413	Q1721L	possibly damaging	Het
Arhgap11a	T	C	2: 113,834,762	Y497C	possibly damaging	Het
Bcl7b	T	G	5: 135,179,970	S96A	possibly damaging	Het
Birc6	T	C	17: 74,642,316	V3111A	probably damaging	Het
Cbx1	A	G	11: 96,801,557	D90G	possibly damaging	Het
Ccdc105	A	G	10: 78,752,472	V168A	probably damaging	Het
Cdkl3	T	C	11: 52,032,468	F524S	possibly damaging	Het
Cops7b	G	A	1: 86,589,309	G44R	probably damaging	Het
D130043K22Rik	A	G	13: 24,899,635	S1028G	probably benign	Het
Decr1	T	A	4: 15,945,351	M1L	probably benign	Het
Dmtn	T	C	14: 70,614,948	I167V	probably benign	Het
Dnah9	A	G	11: 65,859,483	L3932P	probably damaging	Het
Ece1	T	A	4: 137,945,141	I365N	probably damaging	Het
Exo5	T	C	4: 120,922,405	T88A	probably benign	Het
Frem3	T	C	8: 80,663,435	Y1772H	probably benign	Het
Gm11639	T	A	11: 105,037,869	M4815K	probably benign	Het
Gm5160	A	G	18: 14,424,874	N3D	possibly damaging	Het
Gm7138	T	A	10: 77,776,883	D21V	unknown	Het
Gm7298	C	A	6: 121,784,682		silent	Het
Gucy2e	A	G	11: 69,236,116	V177A	probably benign	Het
Islr	C	A	9: 58,156,973	G417V	unknown	Het
Kif13a	A	T	13: 46,761,337	M1458K	possibly damaging	Het
Mcm7	T	C	5: 138,165,085	D642G	possibly damaging	Het
Med24	A	T	11: 98,705,144	I941N	probably damaging	Het
Mrgprb8	C	T	7: 48,389,228	P216S	possibly damaging	Het
Myo5c	T	A	9: 75,242,772	V13D	probably damaging	Het
N4bp2	T	A	5: 65,808,208	I1200K	possibly damaging	Het
Naip6	G	A	13: 100,300,653	T454M	possibly damaging	Het
Nfkb1	T	C	3: 135,589,452	Y877C	probably damaging	Het
Nolc1	C	A	19: 46,083,032	S473R	unknown	Het
Nop16	A	C	13: 54,589,859		probably benign	Het
Nr3c2	T	C	8: 77,242,463	I959T	probably damaging	Het
Nup88	T	G	11: 70,944,115	K692N	probably benign	Het
Nvl	C	A	1: 181,095,054	G818V	probably benign	Het
Olfr1046	T	C	2: 86,216,856	I285V	probably damaging	Het
Olfr1193	T	C	2: 88,678,611	V245A	probably benign	Het
Olfr1357	G	T	10: 78,612,140	T167N	probably benign	Het
Olfr731	T	A	14: 50,237,919	E322V	probably benign	Het
Olfr732	A	G	14: 50,281,779	I158T	probably benign	Het
Olfr913	A	T	9: 38,595,109	D296V	probably damaging	Het
Plxnc1	G	A	10: 94,799,278	S1362L	probably damaging	Het
Ppfia2	C	T	10: 106,858,253	A696V	probably damaging	Het
Prl	A	G	13: 27,059,532	Y62C	probably damaging	Het
Rnf135	A	G	11: 80,198,936	D366G	probably damaging	Het
Rrp8	A	G	7: 105,735,037	L86P	probably damaging	Het
Rsph4a	T	C	10: 33,909,449	V452A	probably damaging	Het
Runx2	C	A	17: 44,639,683	V410L	probably benign	Het
Sik3	T	C	9: 46,209,067	S745P	probably damaging	Het
Slc35e1	T	A	8: 72,488,129	S250C	probably damaging	Het
Snx31	A	G	15: 36,537,552	F160S	probably damaging	Het
Stim2	T	A	5: 53,998,915	V11E	probably benign	Het
Tmem135	G	C	7: 89,147,978	L357V	probably benign	Het
Tox4	T	C	14: 52,286,861	S151P	probably damaging	Het
Trim34b	A	T	7: 104,336,112	D318V	probably damaging	Het
Ubtd1	T	C	19: 42,033,756	S156P	probably damaging	Het
Usp34	C	A	11: 23,484,143	L3240M		Het
Vmn1r56	T	C	7: 5,195,806	S271G	probably damaging	Het
Vps13b	T	C	15: 35,472,066		probably benign	Het
Vps13c	T	C	9: 67,945,828	F2401S	probably damaging	Het
Zbtb11	G	A	16: 55,982,274	V216I	probably damaging	Het
Zfp931	T	C	2: 178,067,796	T266A	possibly damaging	Het
Zfp956	A	G	6: 47,956,108	M106V	probably benign	Het

Other mutations in Samd9l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00538:Samd9l	APN	6	3376779	missense	probably damaging	0.96
IGL00550:Samd9l	APN	6	3374594	missense	probably benign	0.00
IGL01100:Samd9l	APN	6	3375863	missense	possibly damaging	0.91
IGL01321:Samd9l	APN	6	3376259	missense	probably benign	0.42
IGL01553:Samd9l	APN	6	3375566	missense	probably damaging	0.99
IGL01575:Samd9l	APN	6	3376734	missense	possibly damaging	0.85
IGL01896:Samd9l	APN	6	3375120	missense	probably benign	0.02
IGL01915:Samd9l	APN	6	3373864	nonsense	probably null
IGL02063:Samd9l	APN	6	3372992	missense	probably damaging	1.00
IGL02066:Samd9l	APN	6	3376575	missense	probably damaging	1.00
IGL02145:Samd9l	APN	6	3374105	missense	probably benign	0.13
IGL02163:Samd9l	APN	6	3374246	missense	possibly damaging	0.90
IGL02256:Samd9l	APN	6	3376197	missense	probably damaging	1.00
IGL02508:Samd9l	APN	6	3374798	missense	probably damaging	1.00
IGL02591:Samd9l	APN	6	3375760	missense	possibly damaging	0.91
IGL02968:Samd9l	APN	6	3376026	missense	probably damaging	1.00
IGL03058:Samd9l	APN	6	3374980	missense	probably damaging	0.99
IGL03068:Samd9l	APN	6	3375348	nonsense	probably null
IGL03160:Samd9l	APN	6	3374894	missense	probably damaging	1.00
IGL03372:Samd9l	APN	6	3375314	missense	probably damaging	1.00
IGL03385:Samd9l	APN	6	3376208	missense	probably damaging	0.99
boston_lager	UTSW	6	3375761	missense	probably benign	0.12
ipa	UTSW	6	3376347	missense	probably damaging	1.00
Paine	UTSW	6	3372716	missense	probably damaging	0.99
samad	UTSW	6	3374032	nonsense	probably null
IGL03054:Samd9l	UTSW	6	3376023	missense	probably damaging	1.00
R0111:Samd9l	UTSW	6	3374946	missense	possibly damaging	0.80
R0112:Samd9l	UTSW	6	3376031	missense	possibly damaging	0.93
R0356:Samd9l	UTSW	6	3375107	missense	possibly damaging	0.69
R0370:Samd9l	UTSW	6	3377264	start gained	probably benign
R0398:Samd9l	UTSW	6	3374502	missense	probably damaging	1.00
R0744:Samd9l	UTSW	6	3372725	missense	possibly damaging	0.92
R0833:Samd9l	UTSW	6	3372725	missense	possibly damaging	0.92
R0880:Samd9l	UTSW	6	3377064	missense	probably damaging	0.99
R1110:Samd9l	UTSW	6	3374267	missense	probably benign	0.44
R1155:Samd9l	UTSW	6	3376939	missense	probably benign	0.01
R1268:Samd9l	UTSW	6	3376113	missense	possibly damaging	0.56
R1293:Samd9l	UTSW	6	3373947	missense	possibly damaging	0.93
R1478:Samd9l	UTSW	6	3376369	missense	probably benign	0.06
R1573:Samd9l	UTSW	6	3375426	missense	probably damaging	0.99
R1590:Samd9l	UTSW	6	3375761	missense	probably benign	0.12
R1611:Samd9l	UTSW	6	3373771	missense	probably benign	0.00
R1754:Samd9l	UTSW	6	3373126	missense	probably damaging	0.96
R1759:Samd9l	UTSW	6	3373401	missense	probably damaging	1.00
R1795:Samd9l	UTSW	6	3375264	nonsense	probably null
R1829:Samd9l	UTSW	6	3375107	missense	possibly damaging	0.69
R1935:Samd9l	UTSW	6	3376269	missense	probably benign	0.01
R2154:Samd9l	UTSW	6	3372945	missense	possibly damaging	0.91
R2228:Samd9l	UTSW	6	3376910	missense	probably benign	0.08
R3622:Samd9l	UTSW	6	3374032	nonsense	probably null
R3903:Samd9l	UTSW	6	3376830	nonsense	probably null
R3904:Samd9l	UTSW	6	3376830	nonsense	probably null
R3945:Samd9l	UTSW	6	3377029	missense	possibly damaging	0.71
R4091:Samd9l	UTSW	6	3376887	missense	probably benign	0.22
R4602:Samd9l	UTSW	6	3373935	missense	probably damaging	1.00
R4602:Samd9l	UTSW	6	3373937	frame shift	probably null
R4618:Samd9l	UTSW	6	3376347	missense	probably damaging	1.00
R4747:Samd9l	UTSW	6	3375504	nonsense	probably null
R4762:Samd9l	UTSW	6	3375623	missense	probably benign	0.01
R4814:Samd9l	UTSW	6	3372863	missense	probably damaging	0.98
R4934:Samd9l	UTSW	6	3375621	nonsense	probably null
R5026:Samd9l	UTSW	6	3375284	missense	possibly damaging	0.75
R5048:Samd9l	UTSW	6	3374157	missense	probably benign	0.35
R5130:Samd9l	UTSW	6	3374548	missense	possibly damaging	0.69
R5271:Samd9l	UTSW	6	3376156	missense	probably benign	0.02
R5328:Samd9l	UTSW	6	3376739	missense	probably damaging	0.99
R5507:Samd9l	UTSW	6	3373898	missense	possibly damaging	0.78
R5587:Samd9l	UTSW	6	3373291	missense	possibly damaging	0.84
R5846:Samd9l	UTSW	6	3376754	missense	probably benign
R5881:Samd9l	UTSW	6	3372716	missense	possibly damaging	0.70
R5889:Samd9l	UTSW	6	3376460	missense	probably damaging	1.00
R6131:Samd9l	UTSW	6	3377252	missense	probably benign	0.00
R6199:Samd9l	UTSW	6	3376686	missense	probably benign	0.13
R6298:Samd9l	UTSW	6	3375383	missense	probably damaging	1.00
R6331:Samd9l	UTSW	6	3376361	missense	probably damaging	1.00
R6489:Samd9l	UTSW	6	3376896	missense	probably benign
R6601:Samd9l	UTSW	6	3377229	missense	possibly damaging	0.74
R6655:Samd9l	UTSW	6	3377247	missense	probably benign	0.22
R6803:Samd9l	UTSW	6	3375446	missense	probably damaging	0.97
R6864:Samd9l	UTSW	6	3374750	missense	probably benign	0.14
R6905:Samd9l	UTSW	6	3375387	missense	probably damaging	0.99
R6919:Samd9l	UTSW	6	3376313	missense	possibly damaging	0.88
R7060:Samd9l	UTSW	6	3372716	missense	probably damaging	0.99
R7073:Samd9l	UTSW	6	3375856	nonsense	probably null
R7250:Samd9l	UTSW	6	3374201	missense	possibly damaging	0.78
R7307:Samd9l	UTSW	6	3372600	nonsense	probably null
R7351:Samd9l	UTSW	6	3374157	missense	probably benign	0.35
R7423:Samd9l	UTSW	6	3374408	missense	probably damaging	1.00
R7610:Samd9l	UTSW	6	3376754	missense	probably benign
R7667:Samd9l	UTSW	6	3375975	missense	possibly damaging	0.87
R7672:Samd9l	UTSW	6	3373646	missense	probably benign	0.16
R7680:Samd9l	UTSW	6	3372569	missense	probably damaging	1.00
R7680:Samd9l	UTSW	6	3376469	missense	probably damaging	1.00
R7814:Samd9l	UTSW	6	3374793	missense	possibly damaging	0.86
R7829:Samd9l	UTSW	6	3374749	missense	probably benign	0.00
R8000:Samd9l	UTSW	6	3373034	missense	probably damaging	1.00
R8098:Samd9l	UTSW	6	3375549	missense	probably damaging	1.00
R8698:Samd9l	UTSW	6	3373843	missense	probably benign	0.06
R8785:Samd9l	UTSW	6	3377064	missense	probably damaging	0.99
R8795:Samd9l	UTSW	6	3374221	nonsense	probably null
R8832:Samd9l	UTSW	6	3374990	missense	probably damaging	1.00
R8954:Samd9l	UTSW	6	3374577	missense	probably damaging	0.98
R9023:Samd9l	UTSW	6	3373791	missense	probably damaging	1.00
R9051:Samd9l	UTSW	6	3373493	missense	probably benign	0.16
R9108:Samd9l	UTSW	6	3373104	missense	possibly damaging	0.71
R9213:Samd9l	UTSW	6	3376856	missense	probably benign	0.23
R9494:Samd9l	UTSW	6	3375830	missense	possibly damaging	0.51
R9504:Samd9l	UTSW	6	3372621	missense	probably benign	0.17
R9655:Samd9l	UTSW	6	3373578	missense	probably benign	0.00
R9688:Samd9l	UTSW	6	3377087	missense	probably damaging	1.00
R9696:Samd9l	UTSW	6	3375078	missense	possibly damaging	0.76
R9721:Samd9l	UTSW	6	3375854	missense	possibly damaging	0.69
X0026:Samd9l	UTSW	6	3375560	missense	probably damaging	1.00
X0066:Samd9l	UTSW	6	3374477	missense	probably damaging	1.00
Z1176:Samd9l	UTSW	6	3376770	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GATATCTTTACTGGTGACTTGCAC -3'
(R):5'- CAGTGATCATGGTCTCAGGG -3'

Sequencing Primer
(F):5'- CACCAACAATTTCCCCGTGTGG -3'
(R):5'- AAACATGTTAGGTGATGTGGTGAC -3'

Posted On

2021-04-30