Incidental Mutation 'R8806:Rsph4a'
ID672073
Institutional Source Beutler Lab
Gene Symbol Rsph4a
Ensembl Gene ENSMUSG00000039552
Gene Nameradial spoke head 4 homolog A (Chlamydomonas)
SynonymsRshl3
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.186) question?
Stock #R8806 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location33905111-33916021 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 33909449 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 452 (V452A)
Ref Sequence ENSEMBL: ENSMUSP00000131647 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000169670]
Predicted Effect probably damaging
Transcript: ENSMUST00000169670
AA Change: V452A

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000131647
Gene: ENSMUSG00000039552
AA Change: V452A

DomainStartEndE-ValueType
low complexity region 80 87 N/A INTRINSIC
Pfam:Radial_spoke 209 695 2.7e-205 PFAM
low complexity region 702 716 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that appears to be a component the radial spoke head, as determined by homology to similar proteins in the biflagellate alga Chlamydomonas reinhardtii and other ciliates. Radial spokes, which are regularly spaced along cilia, sperm, and flagella axonemes, consist of a thin 'stalk' and a bulbous 'head' that form a signal transduction scaffold between the central pair of microtubules and dynein. Mutations in this gene cause primary ciliary dyskinesia 1, a disease arising from dysmotility of motile cilia and sperm. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2009]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik A G 4: 42,971,261 D198G probably benign Het
Abca1 T C 4: 53,084,520 M586V probably benign Het
Adam6b G A 12: 113,491,798 R745H possibly damaging Het
Afg3l1 A G 8: 123,493,918 D462G probably damaging Het
Anapc1 T A 2: 128,622,413 Q1721L possibly damaging Het
Arhgap11a T C 2: 113,834,762 Y497C possibly damaging Het
Bcl7b T G 5: 135,179,970 S96A possibly damaging Het
Birc6 T C 17: 74,642,316 V3111A probably damaging Het
Cbx1 A G 11: 96,801,557 D90G possibly damaging Het
Ccdc105 A G 10: 78,752,472 V168A probably damaging Het
Cdkl3 T C 11: 52,032,468 F524S possibly damaging Het
Cops7b G A 1: 86,589,309 G44R probably damaging Het
D130043K22Rik A G 13: 24,899,635 S1028G probably benign Het
Decr1 T A 4: 15,945,351 M1L probably benign Het
Dmtn T C 14: 70,614,948 I167V probably benign Het
Dnah9 A G 11: 65,859,483 L3932P probably damaging Het
Ece1 T A 4: 137,945,141 I365N probably damaging Het
Exo5 T C 4: 120,922,405 T88A probably benign Het
Frem3 T C 8: 80,663,435 Y1772H probably benign Het
Gm11639 T A 11: 105,037,869 M4815K probably benign Het
Gm5160 A G 18: 14,424,874 N3D possibly damaging Het
Gm7138 T A 10: 77,776,883 D21V unknown Het
Gucy2e A G 11: 69,236,116 V177A probably benign Het
Islr C A 9: 58,156,973 G417V unknown Het
Kif13a A T 13: 46,761,337 M1458K possibly damaging Het
Mcm7 T C 5: 138,165,085 D642G possibly damaging Het
Med24 A T 11: 98,705,144 I941N probably damaging Het
Mrgprb8 C T 7: 48,389,228 P216S possibly damaging Het
Myo5c T A 9: 75,242,772 V13D probably damaging Het
N4bp2 T A 5: 65,808,208 I1200K possibly damaging Het
Naip6 G A 13: 100,300,653 T454M possibly damaging Het
Nfkb1 T C 3: 135,589,452 Y877C probably damaging Het
Nolc1 C A 19: 46,083,032 S473R unknown Het
Nop16 A C 13: 54,589,859 probably benign Het
Nr3c2 T C 8: 77,242,463 I959T probably damaging Het
Nup88 T G 11: 70,944,115 K692N probably benign Het
Nvl C A 1: 181,095,054 G818V probably benign Het
Olfr1046 T C 2: 86,216,856 I285V probably damaging Het
Olfr1193 T C 2: 88,678,611 V245A probably benign Het
Olfr1357 G T 10: 78,612,140 T167N probably benign Het
Olfr731 T A 14: 50,237,919 E322V probably benign Het
Olfr732 A G 14: 50,281,779 I158T probably benign Het
Olfr913 A T 9: 38,595,109 D296V probably damaging Het
Plxnc1 G A 10: 94,799,278 S1362L probably damaging Het
Ppfia2 C T 10: 106,858,253 A696V probably damaging Het
Prl A G 13: 27,059,532 Y62C probably damaging Het
Rnf135 A G 11: 80,198,936 D366G probably damaging Het
Rrp8 A G 7: 105,735,037 L86P probably damaging Het
Runx2 C A 17: 44,639,683 V410L probably benign Het
Samd9l T C 6: 3,376,665 T199A probably damaging Het
Sik3 T C 9: 46,209,067 S745P probably damaging Het
Slc35e1 T A 8: 72,488,129 S250C probably damaging Het
Snx31 A G 15: 36,537,552 F160S probably damaging Het
Stim2 T A 5: 53,998,915 V11E probably benign Het
Tmem135 G C 7: 89,147,978 L357V probably benign Het
Tox4 T C 14: 52,286,861 S151P probably damaging Het
Trim34b A T 7: 104,336,112 D318V probably damaging Het
Ubtd1 T C 19: 42,033,756 S156P probably damaging Het
Usp34 C A 11: 23,484,143 L3240M Het
Vmn1r56 T C 7: 5,195,806 S271G probably damaging Het
Vps13b T C 15: 35,472,066 probably benign Het
Vps13c T C 9: 67,945,828 F2401S probably damaging Het
Zbtb11 G A 16: 55,982,274 V216I probably damaging Het
Zfp931 T C 2: 178,067,796 T266A possibly damaging Het
Zfp956 A G 6: 47,956,108 M106V probably benign Het
Other mutations in Rsph4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Rsph4a APN 10 33914343 missense probably damaging 1.00
IGL00536:Rsph4a APN 10 33911656 splice site probably benign
IGL00702:Rsph4a APN 10 33913072 missense probably damaging 0.99
IGL02313:Rsph4a APN 10 33905525 missense possibly damaging 0.56
IGL02556:Rsph4a APN 10 33905152 utr 5 prime probably benign
PIT4519001:Rsph4a UTSW 10 33909130 missense probably benign 0.09
R0006:Rsph4a UTSW 10 33909148 missense probably damaging 1.00
R0006:Rsph4a UTSW 10 33909148 missense probably damaging 1.00
R0088:Rsph4a UTSW 10 33909353 missense probably benign 0.15
R0513:Rsph4a UTSW 10 33912991 nonsense probably null
R1559:Rsph4a UTSW 10 33909731 missense probably damaging 0.99
R1589:Rsph4a UTSW 10 33905529 missense probably benign 0.01
R1783:Rsph4a UTSW 10 33911636 missense probably damaging 1.00
R1914:Rsph4a UTSW 10 33913072 missense probably damaging 0.99
R2046:Rsph4a UTSW 10 33914543 unclassified probably benign
R2280:Rsph4a UTSW 10 33911599 missense probably benign 0.00
R2496:Rsph4a UTSW 10 33908098 missense possibly damaging 0.87
R3084:Rsph4a UTSW 10 33909202 missense probably damaging 1.00
R3086:Rsph4a UTSW 10 33909202 missense probably damaging 1.00
R4519:Rsph4a UTSW 10 33911627 nonsense probably null
R4965:Rsph4a UTSW 10 33909240 missense probably damaging 1.00
R5077:Rsph4a UTSW 10 33908279 missense probably damaging 1.00
R5264:Rsph4a UTSW 10 33909383 missense probably damaging 1.00
R5359:Rsph4a UTSW 10 33908236 missense probably benign 0.08
R5464:Rsph4a UTSW 10 33909341 missense possibly damaging 0.64
R5615:Rsph4a UTSW 10 33909328 missense probably benign 0.32
R5751:Rsph4a UTSW 10 33905793 missense probably damaging 0.99
R5763:Rsph4a UTSW 10 33905688 missense probably damaging 0.98
R5832:Rsph4a UTSW 10 33909502 missense probably benign 0.01
R6243:Rsph4a UTSW 10 33909143 missense probably damaging 1.00
R6654:Rsph4a UTSW 10 33912992 missense probably benign
R6918:Rsph4a UTSW 10 33905276 missense probably benign 0.00
R7081:Rsph4a UTSW 10 33909193 missense probably damaging 0.97
R7453:Rsph4a UTSW 10 33909293 missense probably benign 0.00
R7611:Rsph4a UTSW 10 33905477 missense probably benign 0.15
R7670:Rsph4a UTSW 10 33909033 missense probably damaging 1.00
R8017:Rsph4a UTSW 10 33909459 missense probably damaging 1.00
R8495:Rsph4a UTSW 10 33905492 missense probably benign 0.00
X0057:Rsph4a UTSW 10 33905727 missense possibly damaging 0.58
X0066:Rsph4a UTSW 10 33913009 missense possibly damaging 0.94
Z1176:Rsph4a UTSW 10 33911643 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTTCTGGGGCAAGATCTTG -3'
(R):5'- CTCATAGCTGTCTCGACCAC -3'

Sequencing Primer
(F):5'- GATCTTGGGTCTGGAAATGAAC -3'
(R):5'- ATAGCTGTCTCGACCACCTTCC -3'
Posted On2021-04-30