Mutagenetix > Incidental Mutation

Incidental Mutation 'R8806:Plxnc1'

672077

Institutional Source

Beutler Lab

Gene Symbol

Plxnc1

Ensembl Gene

ENSMUSG00000074785

Gene Name

plexin C1

Synonyms

CD232, vespr, 2510048K12Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.417) question?

Stock #

R8806 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

94790866-94944835 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 94799278 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Leucine at position 1362 (S1362L)

Ref Sequence

ENSEMBL: ENSMUSP00000096939 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000099337]

AlphaFold

Q9QZC2

Predicted Effect

probably damaging
Transcript: ENSMUST00000099337
AA Change: S1362L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000096939
Gene: ENSMUSG00000074785
AA Change: S1362L

Domain	Start	End	E-Value	Type
signal peptide	1	34	N/A	INTRINSIC
Pfam:Sema	87	431	5.5e-10	PFAM
PSI	454	507	5.28e-12	SMART
PSI	590	634	1.07e-3	SMART
Pfam:TIG	665	752	3.7e-9	PFAM
IPT	755	847	5.14e-7	SMART
IPT	849	954	1.8e-2	SMART
low complexity region	978	997	N/A	INTRINSIC
Pfam:Plexin_cytopl	1018	1541	1.4e-199	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.4%

Validation Efficiency

100% (66/66)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the plexin family. Plexins are transmembrane receptors for semaphorins, a large family of proteins that regulate axon guidance, cell motility and migration, and the immune response. The encoded protein and its ligand regulate melanocyte adhesion, and viral semaphorins may modulate the immune response by binding to this receptor. The encoded protein may be a tumor suppressor protein for melanoma. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Jan 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal neuron morphology and migration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700022I11Rik	A	G	4: 42,971,261	D198G	probably benign	Het
Abca1	T	C	4: 53,084,520	M586V	probably benign	Het
Adam6b	G	A	12: 113,491,798	R745H	possibly damaging	Het
Afg3l1	A	G	8: 123,493,918	D462G	probably damaging	Het
Anapc1	T	A	2: 128,622,413	Q1721L	possibly damaging	Het
Arhgap11a	T	C	2: 113,834,762	Y497C	possibly damaging	Het
Bcl7b	T	G	5: 135,179,970	S96A	possibly damaging	Het
Birc6	T	C	17: 74,642,316	V3111A	probably damaging	Het
Cbx1	A	G	11: 96,801,557	D90G	possibly damaging	Het
Ccdc105	A	G	10: 78,752,472	V168A	probably damaging	Het
Cdkl3	T	C	11: 52,032,468	F524S	possibly damaging	Het
Cops7b	G	A	1: 86,589,309	G44R	probably damaging	Het
D130043K22Rik	A	G	13: 24,899,635	S1028G	probably benign	Het
Decr1	T	A	4: 15,945,351	M1L	probably benign	Het
Dmtn	T	C	14: 70,614,948	I167V	probably benign	Het
Dnah9	A	G	11: 65,859,483	L3932P	probably damaging	Het
Ece1	T	A	4: 137,945,141	I365N	probably damaging	Het
Exo5	T	C	4: 120,922,405	T88A	probably benign	Het
Frem3	T	C	8: 80,663,435	Y1772H	probably benign	Het
Gm11639	T	A	11: 105,037,869	M4815K	probably benign	Het
Gm5160	A	G	18: 14,424,874	N3D	possibly damaging	Het
Gm7138	T	A	10: 77,776,883	D21V	unknown	Het
Gm7298	C	A	6: 121,784,682		silent	Het
Gucy2e	A	G	11: 69,236,116	V177A	probably benign	Het
Islr	C	A	9: 58,156,973	G417V	unknown	Het
Kif13a	A	T	13: 46,761,337	M1458K	possibly damaging	Het
Mcm7	T	C	5: 138,165,085	D642G	possibly damaging	Het
Med24	A	T	11: 98,705,144	I941N	probably damaging	Het
Mrgprb8	C	T	7: 48,389,228	P216S	possibly damaging	Het
Myo5c	T	A	9: 75,242,772	V13D	probably damaging	Het
N4bp2	T	A	5: 65,808,208	I1200K	possibly damaging	Het
Naip6	G	A	13: 100,300,653	T454M	possibly damaging	Het
Nfkb1	T	C	3: 135,589,452	Y877C	probably damaging	Het
Nolc1	C	A	19: 46,083,032	S473R	unknown	Het
Nop16	A	C	13: 54,589,859		probably benign	Het
Nr3c2	T	C	8: 77,242,463	I959T	probably damaging	Het
Nup88	T	G	11: 70,944,115	K692N	probably benign	Het
Nvl	C	A	1: 181,095,054	G818V	probably benign	Het
Olfr1046	T	C	2: 86,216,856	I285V	probably damaging	Het
Olfr1193	T	C	2: 88,678,611	V245A	probably benign	Het
Olfr1357	G	T	10: 78,612,140	T167N	probably benign	Het
Olfr731	T	A	14: 50,237,919	E322V	probably benign	Het
Olfr732	A	G	14: 50,281,779	I158T	probably benign	Het
Olfr913	A	T	9: 38,595,109	D296V	probably damaging	Het
Ppfia2	C	T	10: 106,858,253	A696V	probably damaging	Het
Prl	A	G	13: 27,059,532	Y62C	probably damaging	Het
Rnf135	A	G	11: 80,198,936	D366G	probably damaging	Het
Rrp8	A	G	7: 105,735,037	L86P	probably damaging	Het
Rsph4a	T	C	10: 33,909,449	V452A	probably damaging	Het
Runx2	C	A	17: 44,639,683	V410L	probably benign	Het
Samd9l	T	C	6: 3,376,665	T199A	probably damaging	Het
Sik3	T	C	9: 46,209,067	S745P	probably damaging	Het
Slc35e1	T	A	8: 72,488,129	S250C	probably damaging	Het
Snx31	A	G	15: 36,537,552	F160S	probably damaging	Het
Stim2	T	A	5: 53,998,915	V11E	probably benign	Het
Tmem135	G	C	7: 89,147,978	L357V	probably benign	Het
Tox4	T	C	14: 52,286,861	S151P	probably damaging	Het
Trim34b	A	T	7: 104,336,112	D318V	probably damaging	Het
Ubtd1	T	C	19: 42,033,756	S156P	probably damaging	Het
Usp34	C	A	11: 23,484,143	L3240M		Het
Vmn1r56	T	C	7: 5,195,806	S271G	probably damaging	Het
Vps13b	T	C	15: 35,472,066		probably benign	Het
Vps13c	T	C	9: 67,945,828	F2401S	probably damaging	Het
Zbtb11	G	A	16: 55,982,274	V216I	probably damaging	Het
Zfp931	T	C	2: 178,067,796	T266A	possibly damaging	Het
Zfp956	A	G	6: 47,956,108	M106V	probably benign	Het

Other mutations in Plxnc1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00843:Plxnc1	APN	10	94847549	missense	probably benign	0.25
IGL01285:Plxnc1	APN	10	94799368	missense	probably damaging	0.99
IGL01867:Plxnc1	APN	10	94798146	missense	possibly damaging	0.61
IGL01994:Plxnc1	APN	10	94849939	missense	probably damaging	1.00
IGL02083:Plxnc1	APN	10	94922725	missense	possibly damaging	0.61
IGL02250:Plxnc1	APN	10	94871031	missense	probably benign	0.00
IGL02429:Plxnc1	APN	10	94882591	missense	probably benign	0.00
IGL02752:Plxnc1	APN	10	94794680	splice site	probably null
IGL02973:Plxnc1	APN	10	94810684	missense	probably damaging	1.00
R0230:Plxnc1	UTSW	10	94799347	missense	probably benign	0.07
R0265:Plxnc1	UTSW	10	94813129	missense	probably benign	0.14
R0271:Plxnc1	UTSW	10	94837918	missense	probably null	1.00
R0299:Plxnc1	UTSW	10	94849821	critical splice donor site	probably null
R0361:Plxnc1	UTSW	10	94865007	missense	probably damaging	1.00
R0441:Plxnc1	UTSW	10	94796482	missense	probably damaging	1.00
R0558:Plxnc1	UTSW	10	94837935	missense	probably damaging	1.00
R0617:Plxnc1	UTSW	10	94799368	missense	probably damaging	1.00
R0671:Plxnc1	UTSW	10	94799332	missense	possibly damaging	0.63
R0692:Plxnc1	UTSW	10	94837500	critical splice donor site	probably null
R0751:Plxnc1	UTSW	10	94831333	splice site	probably benign
R1184:Plxnc1	UTSW	10	94831333	splice site	probably benign
R1260:Plxnc1	UTSW	10	94831365	missense	probably damaging	0.99
R1680:Plxnc1	UTSW	10	94841551	missense	probably benign	0.14
R1746:Plxnc1	UTSW	10	94844179	splice site	probably null
R1750:Plxnc1	UTSW	10	94799497	missense	probably damaging	1.00
R1751:Plxnc1	UTSW	10	94849815	unclassified	probably benign
R1768:Plxnc1	UTSW	10	94844322	missense	probably benign	0.05
R1876:Plxnc1	UTSW	10	94866941	missense	possibly damaging	0.94
R2004:Plxnc1	UTSW	10	94852622	missense	probably damaging	0.98
R2031:Plxnc1	UTSW	10	94943667	missense	probably benign	0.26
R2184:Plxnc1	UTSW	10	94944269	missense	probably damaging	1.00
R2437:Plxnc1	UTSW	10	94906533	missense	probably benign	0.02
R2927:Plxnc1	UTSW	10	94793292	critical splice acceptor site	probably null
R3001:Plxnc1	UTSW	10	94793218	missense	probably damaging	0.98
R3002:Plxnc1	UTSW	10	94793218	missense	probably damaging	0.98
R3003:Plxnc1	UTSW	10	94793218	missense	probably damaging	0.98
R3441:Plxnc1	UTSW	10	94871010	missense	probably benign	0.00
R3849:Plxnc1	UTSW	10	94794432	missense	probably benign	0.01
R3884:Plxnc1	UTSW	10	94910687	splice site	probably null
R4004:Plxnc1	UTSW	10	94794597	nonsense	probably null
R4679:Plxnc1	UTSW	10	94794444	missense	probably damaging	1.00
R4730:Plxnc1	UTSW	10	94867468	intron	probably benign
R4937:Plxnc1	UTSW	10	94841473	missense	probably damaging	1.00
R5068:Plxnc1	UTSW	10	94799377	missense	possibly damaging	0.91
R5345:Plxnc1	UTSW	10	94849969	missense	probably benign	0.26
R5397:Plxnc1	UTSW	10	94843752	missense	probably benign	0.08
R5416:Plxnc1	UTSW	10	94837554	missense	probably damaging	1.00
R5485:Plxnc1	UTSW	10	94922742	missense	probably benign	0.00
R5543:Plxnc1	UTSW	10	94864774	missense	probably benign
R5826:Plxnc1	UTSW	10	94799473	critical splice donor site	probably null
R6007:Plxnc1	UTSW	10	94793290	missense	possibly damaging	0.88
R6018:Plxnc1	UTSW	10	94943848	missense	probably benign	0.21
R6052:Plxnc1	UTSW	10	94943773	missense	probably benign	0.13
R6291:Plxnc1	UTSW	10	94833642	splice site	probably null
R6653:Plxnc1	UTSW	10	94943876	missense	probably damaging	1.00
R6984:Plxnc1	UTSW	10	94831530	missense	probably damaging	1.00
R7086:Plxnc1	UTSW	10	94831435	missense	probably benign
R7401:Plxnc1	UTSW	10	94871005	missense	probably benign
R7727:Plxnc1	UTSW	10	94944109	missense	probably damaging	1.00
R7789:Plxnc1	UTSW	10	94794477	missense	probably damaging	1.00
R7803:Plxnc1	UTSW	10	94943515	critical splice donor site	probably null
R7809:Plxnc1	UTSW	10	94794440	missense	probably damaging	1.00
R7882:Plxnc1	UTSW	10	94843836	missense	probably benign
R8103:Plxnc1	UTSW	10	94871082	missense	probably benign
R8226:Plxnc1	UTSW	10	94833368	missense	possibly damaging	0.90
R8273:Plxnc1	UTSW	10	94813243	missense	probably benign	0.14
R8299:Plxnc1	UTSW	10	94827179	missense	probably benign	0.35
R8392:Plxnc1	UTSW	10	94801490	missense	possibly damaging	0.75
R8758:Plxnc1	UTSW	10	94922745	missense	possibly damaging	0.91
R8882:Plxnc1	UTSW	10	94841566	missense	probably damaging	1.00
R8893:Plxnc1	UTSW	10	94849847	missense	probably benign	0.35
R8956:Plxnc1	UTSW	10	94910586	missense	probably benign	0.00
R9040:Plxnc1	UTSW	10	94943517	nonsense	probably null
R9102:Plxnc1	UTSW	10	94827245	missense	probably damaging	1.00
R9225:Plxnc1	UTSW	10	94793199	missense	probably damaging	1.00
R9324:Plxnc1	UTSW	10	94944823	start gained	probably benign
R9368:Plxnc1	UTSW	10	94864737	nonsense	probably null
R9375:Plxnc1	UTSW	10	94813231	missense	probably benign	0.20
R9430:Plxnc1	UTSW	10	94922682	missense	probably benign	0.01
R9460:Plxnc1	UTSW	10	94865033	missense	probably benign
R9498:Plxnc1	UTSW	10	94813142	missense	possibly damaging	0.48
RF003:Plxnc1	UTSW	10	94794444	missense	probably damaging	1.00
RF045:Plxnc1	UTSW	10	94865007	missense	probably damaging	1.00
RF046:Plxnc1	UTSW	10	94865007	missense	probably damaging	1.00
RF047:Plxnc1	UTSW	10	94865007	missense	probably damaging	1.00
X0024:Plxnc1	UTSW	10	94864715	critical splice donor site	probably null
Z1176:Plxnc1	UTSW	10	94865029	missense	probably benign	0.16

Predicted Primers

PCR Primer
(F):5'- CTGACTGAAGATGCTGCAGGAG -3'
(R):5'- CACTGCCACTTGGTGAGTTTG -3'

Sequencing Primer
(F):5'- CAGGAGGAATTTATGAAGTGCTCTTC -3'
(R):5'- GCTTGTGCTGCCCACTG -3'

Posted On

2021-04-30