Incidental Mutation 'R8806:Gucy2e'
ID672082
Institutional Source Beutler Lab
Gene Symbol Gucy2e
Ensembl Gene ENSMUSG00000020890
Gene Nameguanylate cyclase 2e
SynonymsGC1, GC-E, ROS-GC1
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.318) question?
Stock #R8806 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location69218117-69237036 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 69236116 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 177 (V177A)
Ref Sequence ENSEMBL: ENSMUSP00000104305 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021259] [ENSMUST00000108664] [ENSMUST00000108665]
Predicted Effect probably benign
Transcript: ENSMUST00000021259
AA Change: V177A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000021259
Gene: ENSMUSG00000020890
AA Change: V177A

DomainStartEndE-ValueType
low complexity region 5 15 N/A INTRINSIC
low complexity region 36 55 N/A INTRINSIC
Pfam:ANF_receptor 75 403 5.3e-37 PFAM
transmembrane domain 468 490 N/A INTRINSIC
Pfam:Pkinase 557 807 1.1e-24 PFAM
Pfam:Pkinase_Tyr 560 807 2e-29 PFAM
CYCc 847 1050 7.78e-104 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108664
AA Change: V177A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000104304
Gene: ENSMUSG00000020890
AA Change: V177A

DomainStartEndE-ValueType
low complexity region 5 15 N/A INTRINSIC
low complexity region 36 55 N/A INTRINSIC
Pfam:ANF_receptor 75 403 2.4e-40 PFAM
transmembrane domain 468 490 N/A INTRINSIC
Pfam:Pkinase 560 807 9.5e-23 PFAM
Pfam:Pkinase_Tyr 560 807 7.7e-29 PFAM
CYCc 847 1050 7.78e-104 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108665
AA Change: V177A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000104305
Gene: ENSMUSG00000020890
AA Change: V177A

DomainStartEndE-ValueType
low complexity region 5 15 N/A INTRINSIC
low complexity region 36 55 N/A INTRINSIC
Pfam:ANF_receptor 75 403 5.3e-37 PFAM
transmembrane domain 468 490 N/A INTRINSIC
Pfam:Pkinase 557 807 1.1e-24 PFAM
Pfam:Pkinase_Tyr 560 807 2e-29 PFAM
CYCc 847 1050 7.78e-104 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155457
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158813
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a retina-specific guanylate cyclase, which is a member of the membrane guanylyl cyclase family. Like other membrane guanylyl cyclases, this enzyme has a hydrophobic amino-terminal signal sequence followed by a large extracellular domain, a single membrane spanning domain, a kinase homology domain, and a guanylyl cyclase catalytic domain. In contrast to other membrane guanylyl cyclases, this enzyme is not activated by natriuretic peptides. Mutations in this gene result in Leber congenital amaurosis and cone-rod dystrophy-6 diseases. [provided by RefSeq, Dec 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal retinal cone cell morphology, impaired cone and rod electrophysiology, and severe retinal cone cell degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik A G 4: 42,971,261 D198G probably benign Het
Abca1 T C 4: 53,084,520 M586V probably benign Het
Adam6b G A 12: 113,491,798 R745H possibly damaging Het
Afg3l1 A G 8: 123,493,918 D462G probably damaging Het
Anapc1 T A 2: 128,622,413 Q1721L possibly damaging Het
Arhgap11a T C 2: 113,834,762 Y497C possibly damaging Het
Bcl7b T G 5: 135,179,970 S96A possibly damaging Het
Birc6 T C 17: 74,642,316 V3111A probably damaging Het
Cbx1 A G 11: 96,801,557 D90G possibly damaging Het
Ccdc105 A G 10: 78,752,472 V168A probably damaging Het
Cdkl3 T C 11: 52,032,468 F524S possibly damaging Het
Cops7b G A 1: 86,589,309 G44R probably damaging Het
D130043K22Rik A G 13: 24,899,635 S1028G probably benign Het
Decr1 T A 4: 15,945,351 M1L probably benign Het
Dmtn T C 14: 70,614,948 I167V probably benign Het
Dnah9 A G 11: 65,859,483 L3932P probably damaging Het
Ece1 T A 4: 137,945,141 I365N probably damaging Het
Exo5 T C 4: 120,922,405 T88A probably benign Het
Frem3 T C 8: 80,663,435 Y1772H probably benign Het
Gm11639 T A 11: 105,037,869 M4815K probably benign Het
Gm5160 A G 18: 14,424,874 N3D possibly damaging Het
Gm7138 T A 10: 77,776,883 D21V unknown Het
Islr C A 9: 58,156,973 G417V unknown Het
Kif13a A T 13: 46,761,337 M1458K possibly damaging Het
Mcm7 T C 5: 138,165,085 D642G possibly damaging Het
Med24 A T 11: 98,705,144 I941N probably damaging Het
Mrgprb8 C T 7: 48,389,228 P216S possibly damaging Het
Myo5c T A 9: 75,242,772 V13D probably damaging Het
N4bp2 T A 5: 65,808,208 I1200K possibly damaging Het
Naip6 G A 13: 100,300,653 T454M possibly damaging Het
Nfkb1 T C 3: 135,589,452 Y877C probably damaging Het
Nolc1 C A 19: 46,083,032 S473R unknown Het
Nop16 A C 13: 54,589,859 probably benign Het
Nr3c2 T C 8: 77,242,463 I959T probably damaging Het
Nup88 T G 11: 70,944,115 K692N probably benign Het
Nvl C A 1: 181,095,054 G818V probably benign Het
Olfr1046 T C 2: 86,216,856 I285V probably damaging Het
Olfr1193 T C 2: 88,678,611 V245A probably benign Het
Olfr1357 G T 10: 78,612,140 T167N probably benign Het
Olfr731 T A 14: 50,237,919 E322V probably benign Het
Olfr732 A G 14: 50,281,779 I158T probably benign Het
Olfr913 A T 9: 38,595,109 D296V probably damaging Het
Plxnc1 G A 10: 94,799,278 S1362L probably damaging Het
Ppfia2 C T 10: 106,858,253 A696V probably damaging Het
Prl A G 13: 27,059,532 Y62C probably damaging Het
Rnf135 A G 11: 80,198,936 D366G probably damaging Het
Rrp8 A G 7: 105,735,037 L86P probably damaging Het
Rsph4a T C 10: 33,909,449 V452A probably damaging Het
Runx2 C A 17: 44,639,683 V410L probably benign Het
Samd9l T C 6: 3,376,665 T199A probably damaging Het
Sik3 T C 9: 46,209,067 S745P probably damaging Het
Slc35e1 T A 8: 72,488,129 S250C probably damaging Het
Snx31 A G 15: 36,537,552 F160S probably damaging Het
Stim2 T A 5: 53,998,915 V11E probably benign Het
Tmem135 G C 7: 89,147,978 L357V probably benign Het
Tox4 T C 14: 52,286,861 S151P probably damaging Het
Trim34b A T 7: 104,336,112 D318V probably damaging Het
Ubtd1 T C 19: 42,033,756 S156P probably damaging Het
Usp34 C A 11: 23,484,143 L3240M Het
Vmn1r56 T C 7: 5,195,806 S271G probably damaging Het
Vps13b T C 15: 35,472,066 probably benign Het
Vps13c T C 9: 67,945,828 F2401S probably damaging Het
Zbtb11 G A 16: 55,982,274 V216I probably damaging Het
Zfp931 T C 2: 178,067,796 T266A possibly damaging Het
Zfp956 A G 6: 47,956,108 M106V probably benign Het
Other mutations in Gucy2e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00916:Gucy2e APN 11 69223097 missense possibly damaging 0.88
IGL01626:Gucy2e APN 11 69232855 missense possibly damaging 0.80
IGL01756:Gucy2e APN 11 69232852 missense probably damaging 0.98
IGL02030:Gucy2e APN 11 69223816 missense probably damaging 1.00
IGL02095:Gucy2e APN 11 69232787 missense possibly damaging 0.48
IGL02387:Gucy2e APN 11 69236116 missense probably benign
IGL02622:Gucy2e APN 11 69225031 missense probably damaging 1.00
IGL02660:Gucy2e APN 11 69232007 missense probably benign 0.18
IGL03181:Gucy2e APN 11 69230182 splice site probably benign
R0110:Gucy2e UTSW 11 69235576 missense probably benign 0.00
R0115:Gucy2e UTSW 11 69236632 missense unknown
R0450:Gucy2e UTSW 11 69235576 missense probably benign 0.00
R0469:Gucy2e UTSW 11 69235576 missense probably benign 0.00
R0497:Gucy2e UTSW 11 69224159 missense probably damaging 1.00
R0510:Gucy2e UTSW 11 69235576 missense probably benign 0.00
R1252:Gucy2e UTSW 11 69235659 missense probably benign
R1535:Gucy2e UTSW 11 69226244 missense probably damaging 1.00
R1700:Gucy2e UTSW 11 69232058 missense probably benign
R2035:Gucy2e UTSW 11 69227532 missense probably benign 0.12
R2179:Gucy2e UTSW 11 69228578 splice site probably null
R3622:Gucy2e UTSW 11 69225051 missense probably damaging 1.00
R4212:Gucy2e UTSW 11 69228123 missense probably damaging 0.99
R4600:Gucy2e UTSW 11 69236168 missense possibly damaging 0.71
R4790:Gucy2e UTSW 11 69228448 missense probably damaging 1.00
R5170:Gucy2e UTSW 11 69235570 missense probably damaging 0.97
R5174:Gucy2e UTSW 11 69236566 missense probably benign
R5440:Gucy2e UTSW 11 69223646 missense probably damaging 0.98
R5586:Gucy2e UTSW 11 69226256 missense probably damaging 1.00
R5668:Gucy2e UTSW 11 69228381 missense probably damaging 1.00
R5820:Gucy2e UTSW 11 69232696 missense probably benign 0.36
R5826:Gucy2e UTSW 11 69236033 missense possibly damaging 0.53
R6169:Gucy2e UTSW 11 69236104 missense probably benign 0.19
R6544:Gucy2e UTSW 11 69235657 missense probably benign
R6815:Gucy2e UTSW 11 69232001 missense possibly damaging 0.86
R7020:Gucy2e UTSW 11 69232793 missense probably benign 0.00
R7592:Gucy2e UTSW 11 69223324 critical splice donor site probably null
R7658:Gucy2e UTSW 11 69226229 nonsense probably null
R7812:Gucy2e UTSW 11 69226243 missense probably damaging 1.00
R8284:Gucy2e UTSW 11 69232351 missense probably benign
R8479:Gucy2e UTSW 11 69232963 missense probably benign 0.22
R8537:Gucy2e UTSW 11 69236353 missense probably benign 0.01
X0025:Gucy2e UTSW 11 69226244 missense probably damaging 1.00
Z1186:Gucy2e UTSW 11 69223605 missense probably benign 0.00
Z1186:Gucy2e UTSW 11 69236603 missense unknown
Z1187:Gucy2e UTSW 11 69223605 missense probably benign 0.00
Z1187:Gucy2e UTSW 11 69236603 missense unknown
Z1188:Gucy2e UTSW 11 69223605 missense probably benign 0.00
Z1188:Gucy2e UTSW 11 69236603 missense unknown
Z1189:Gucy2e UTSW 11 69223605 missense probably benign 0.00
Z1189:Gucy2e UTSW 11 69236603 missense unknown
Z1190:Gucy2e UTSW 11 69223605 missense probably benign 0.00
Z1190:Gucy2e UTSW 11 69236603 missense unknown
Z1191:Gucy2e UTSW 11 69223605 missense probably benign 0.00
Z1191:Gucy2e UTSW 11 69236603 missense unknown
Z1192:Gucy2e UTSW 11 69223605 missense probably benign 0.00
Z1192:Gucy2e UTSW 11 69236603 missense unknown
Predicted Primers PCR Primer
(F):5'- CTAACTCTAGGCCCATCTCGGATC -3'
(R):5'- GACTTTGCTTTAGACGGCGG -3'

Sequencing Primer
(F):5'- GCCCATCTCGGATCCTCCC -3'
(R):5'- TCACTAGGGGCTGTGTCCTC -3'
Posted On2021-04-30