Incidental Mutation 'R8806:Nup88'
ID672083
Institutional Source Beutler Lab
Gene Symbol Nup88
Ensembl Gene ENSMUSG00000040667
Gene Namenucleoporin 88
SynonymsNup84, Prei2
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.968) question?
Stock #R8806 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location70943058-70969973 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 70944115 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 692 (K692N)
Ref Sequence ENSEMBL: ENSMUSP00000048101 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035283] [ENSMUST00000076270] [ENSMUST00000081362] [ENSMUST00000100928] [ENSMUST00000108530] [ENSMUST00000108531] [ENSMUST00000108533] [ENSMUST00000177731] [ENSMUST00000178245]
Predicted Effect probably benign
Transcript: ENSMUST00000035283
AA Change: K692N

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000048101
Gene: ENSMUSG00000040667
AA Change: K692N

DomainStartEndE-ValueType
Pfam:Nup88 13 752 1.1e-306 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000076270
SMART Domains Protein: ENSMUSP00000075619
Gene: ENSMUSG00000020817

DomainStartEndE-ValueType
Pfam:Rabaptin 89 195 8.8e-47 PFAM
low complexity region 314 327 N/A INTRINSIC
Pfam:Rabaptin 461 596 7.6e-39 PFAM
Pfam:Rab5-bind 612 807 5.7e-51 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000081362
SMART Domains Protein: ENSMUSP00000080102
Gene: ENSMUSG00000020817

DomainStartEndE-ValueType
Pfam:Rabaptin 89 198 2.4e-45 PFAM
low complexity region 274 287 N/A INTRINSIC
Pfam:Rabaptin 421 556 7.1e-39 PFAM
Pfam:Rab5-bind 572 767 5.2e-51 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000100928
SMART Domains Protein: ENSMUSP00000098488
Gene: ENSMUSG00000020817

DomainStartEndE-ValueType
Pfam:Rabaptin 89 195 8.3e-47 PFAM
low complexity region 314 327 N/A INTRINSIC
Pfam:Rabaptin 461 561 2.9e-27 PFAM
Pfam:Rab5-bind 577 772 5.3e-51 PFAM
low complexity region 803 817 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108530
AA Change: K681N

PolyPhen 2 Score 0.426 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000104170
Gene: ENSMUSG00000040667
AA Change: K681N

DomainStartEndE-ValueType
Pfam:Nup88 11 742 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108531
AA Change: K686N

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000104171
Gene: ENSMUSG00000040667
AA Change: K686N

DomainStartEndE-ValueType
Pfam:Nup88 11 747 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108533
SMART Domains Protein: ENSMUSP00000104173
Gene: ENSMUSG00000020817

DomainStartEndE-ValueType
Pfam:Rabaptin 9 495 2.8e-301 PFAM
Pfam:Rab5-bind 533 841 2e-142 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177731
SMART Domains Protein: ENSMUSP00000136069
Gene: ENSMUSG00000020817

DomainStartEndE-ValueType
Pfam:Rabaptin 5 111 6.2e-47 PFAM
low complexity region 230 243 N/A INTRINSIC
Pfam:Rabaptin 377 512 5.3e-39 PFAM
Pfam:Rab5-bind 528 723 1.4e-50 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000178245
SMART Domains Protein: ENSMUSP00000137267
Gene: ENSMUSG00000020817

DomainStartEndE-ValueType
Pfam:Rabaptin 46 152 8.2e-47 PFAM
low complexity region 271 284 N/A INTRINSIC
Pfam:Rabaptin 418 553 7e-39 PFAM
Pfam:Rab5-bind 569 764 5.2e-51 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000178253
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The nuclear pore complex is a massive structure that extends across the nuclear envelope, forming a gateway that regulates the flow of macromolecules between the nucleus and the cytoplasm. Nucleoporins, a family of 50 to 100 proteins, are the main components of the nuclear pore complex in eukaryotic cells. The protein encoded by this gene belongs to the nucleoporin family and is associated with the oncogenic nucleoporin CAN/Nup214 in a dynamic subcomplex. This protein is also overexpressed in a large number of malignant neoplasms and precancerous dysplasias. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2016]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik A G 4: 42,971,261 D198G probably benign Het
Abca1 T C 4: 53,084,520 M586V probably benign Het
Adam6b G A 12: 113,491,798 R745H possibly damaging Het
Afg3l1 A G 8: 123,493,918 D462G probably damaging Het
Anapc1 T A 2: 128,622,413 Q1721L possibly damaging Het
Arhgap11a T C 2: 113,834,762 Y497C possibly damaging Het
Bcl7b T G 5: 135,179,970 S96A possibly damaging Het
Birc6 T C 17: 74,642,316 V3111A probably damaging Het
Cbx1 A G 11: 96,801,557 D90G possibly damaging Het
Ccdc105 A G 10: 78,752,472 V168A probably damaging Het
Cdkl3 T C 11: 52,032,468 F524S possibly damaging Het
Cops7b G A 1: 86,589,309 G44R probably damaging Het
D130043K22Rik A G 13: 24,899,635 S1028G probably benign Het
Decr1 T A 4: 15,945,351 M1L probably benign Het
Dmtn T C 14: 70,614,948 I167V probably benign Het
Dnah9 A G 11: 65,859,483 L3932P probably damaging Het
Ece1 T A 4: 137,945,141 I365N probably damaging Het
Exo5 T C 4: 120,922,405 T88A probably benign Het
Frem3 T C 8: 80,663,435 Y1772H probably benign Het
Gm11639 T A 11: 105,037,869 M4815K probably benign Het
Gm5160 A G 18: 14,424,874 N3D possibly damaging Het
Gm7138 T A 10: 77,776,883 D21V unknown Het
Gucy2e A G 11: 69,236,116 V177A probably benign Het
Islr C A 9: 58,156,973 G417V unknown Het
Kif13a A T 13: 46,761,337 M1458K possibly damaging Het
Mcm7 T C 5: 138,165,085 D642G possibly damaging Het
Med24 A T 11: 98,705,144 I941N probably damaging Het
Mrgprb8 C T 7: 48,389,228 P216S possibly damaging Het
Myo5c T A 9: 75,242,772 V13D probably damaging Het
N4bp2 T A 5: 65,808,208 I1200K possibly damaging Het
Naip6 G A 13: 100,300,653 T454M possibly damaging Het
Nfkb1 T C 3: 135,589,452 Y877C probably damaging Het
Nolc1 C A 19: 46,083,032 S473R unknown Het
Nop16 A C 13: 54,589,859 probably benign Het
Nr3c2 T C 8: 77,242,463 I959T probably damaging Het
Nvl C A 1: 181,095,054 G818V probably benign Het
Olfr1046 T C 2: 86,216,856 I285V probably damaging Het
Olfr1193 T C 2: 88,678,611 V245A probably benign Het
Olfr1357 G T 10: 78,612,140 T167N probably benign Het
Olfr731 T A 14: 50,237,919 E322V probably benign Het
Olfr732 A G 14: 50,281,779 I158T probably benign Het
Olfr913 A T 9: 38,595,109 D296V probably damaging Het
Plxnc1 G A 10: 94,799,278 S1362L probably damaging Het
Ppfia2 C T 10: 106,858,253 A696V probably damaging Het
Prl A G 13: 27,059,532 Y62C probably damaging Het
Rnf135 A G 11: 80,198,936 D366G probably damaging Het
Rrp8 A G 7: 105,735,037 L86P probably damaging Het
Rsph4a T C 10: 33,909,449 V452A probably damaging Het
Runx2 C A 17: 44,639,683 V410L probably benign Het
Samd9l T C 6: 3,376,665 T199A probably damaging Het
Sik3 T C 9: 46,209,067 S745P probably damaging Het
Slc35e1 T A 8: 72,488,129 S250C probably damaging Het
Snx31 A G 15: 36,537,552 F160S probably damaging Het
Stim2 T A 5: 53,998,915 V11E probably benign Het
Tmem135 G C 7: 89,147,978 L357V probably benign Het
Tox4 T C 14: 52,286,861 S151P probably damaging Het
Trim34b A T 7: 104,336,112 D318V probably damaging Het
Ubtd1 T C 19: 42,033,756 S156P probably damaging Het
Usp34 C A 11: 23,484,143 L3240M Het
Vmn1r56 T C 7: 5,195,806 S271G probably damaging Het
Vps13b T C 15: 35,472,066 probably benign Het
Vps13c T C 9: 67,945,828 F2401S probably damaging Het
Zbtb11 G A 16: 55,982,274 V216I probably damaging Het
Zfp931 T C 2: 178,067,796 T266A possibly damaging Het
Zfp956 A G 6: 47,956,108 M106V probably benign Het
Other mutations in Nup88
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02081:Nup88 APN 11 70954654 splice site probably benign
IGL02219:Nup88 APN 11 70969692 missense probably benign 0.45
IGL02433:Nup88 APN 11 70969888 missense probably benign 0.13
IGL02666:Nup88 APN 11 70943869 intron probably benign
IGL02669:Nup88 APN 11 70956284 missense probably damaging 0.99
IGL02951:Nup88 APN 11 70944872 missense possibly damaging 0.94
unholy UTSW 11 70956192 missense probably damaging 1.00
PIT4515001:Nup88 UTSW 11 70944721 missense probably benign 0.00
R0445:Nup88 UTSW 11 70947729 missense probably benign 0.44
R0737:Nup88 UTSW 11 70969950 start codon destroyed probably null 0.90
R0920:Nup88 UTSW 11 70956320 missense possibly damaging 0.80
R1337:Nup88 UTSW 11 70944890 missense probably damaging 1.00
R2208:Nup88 UTSW 11 70965719 missense probably damaging 1.00
R3735:Nup88 UTSW 11 70956192 missense probably damaging 1.00
R4577:Nup88 UTSW 11 70969717 missense probably damaging 0.96
R4600:Nup88 UTSW 11 70969696 nonsense probably null
R4663:Nup88 UTSW 11 70965846 splice site probably null
R4812:Nup88 UTSW 11 70965726 missense probably damaging 1.00
R4824:Nup88 UTSW 11 70961624 missense probably benign 0.10
R5333:Nup88 UTSW 11 70945016 intron probably benign
R5338:Nup88 UTSW 11 70944908 missense probably damaging 0.98
R5443:Nup88 UTSW 11 70958430 nonsense probably null
R5605:Nup88 UTSW 11 70944070 intron probably benign
R5869:Nup88 UTSW 11 70969671 missense probably benign 0.01
R6287:Nup88 UTSW 11 70965755 missense probably benign 0.39
R6364:Nup88 UTSW 11 70947786 missense probably benign
R6409:Nup88 UTSW 11 70944972 missense probably null 0.71
R6555:Nup88 UTSW 11 70944180 missense possibly damaging 0.62
R7203:Nup88 UTSW 11 70945254 missense probably benign 0.20
R7606:Nup88 UTSW 11 70961615 missense possibly damaging 0.89
R7620:Nup88 UTSW 11 70969779 missense probably benign 0.00
R7681:Nup88 UTSW 11 70969885 missense probably benign 0.05
R8283:Nup88 UTSW 11 70958340 missense probably benign
R8379:Nup88 UTSW 11 70969781 missense possibly damaging 0.72
R8684:Nup88 UTSW 11 70969861 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACTTTCGCTGGTAGGCACTG -3'
(R):5'- CCTCACCAAATTCTTGAGCTAC -3'

Sequencing Primer
(F):5'- CTGGTAGGCACTGAGAGTAATG -3'
(R):5'- TGAGCTACAAACTTTGTTTCTCTTG -3'
Posted On2021-04-30