Incidental Mutation 'R8806:Cbx1'
ID672085
Institutional Source Beutler Lab
Gene Symbol Cbx1
Ensembl Gene ENSMUSG00000018666
Gene Namechromobox 1
SynonymsM31, MOD1, Hp1beta, Cbx-rs2, E430007M08Rik, HP1B
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8806 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location96789127-96808640 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 96801557 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 90 (D90G)
Ref Sequence ENSEMBL: ENSMUSP00000091475 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018810] [ENSMUST00000079702] [ENSMUST00000093943] [ENSMUST00000134585]
PDB Structure STRUCTURE OF THE CHROMATIN BINDING (CHROMO) DOMAIN FROM MOUSE MODIFIER PROTEIN 1, NMR, 26 STRUCTURES [SOLUTION NMR]
MOUSE HP1 (M31) C TERMINAL (SHADOW CHROMO) DOMAIN [SOLUTION NMR]
STRUCTURE OF THE CHROMODOMAIN FROM MOUSE HP1BETA IN COMPLEX WITH THE LYSINE 9-METHYL HISTONE H3 N-TERMINAL PEPTIDE, NMR, 25 STRUCTURES [SOLUTION NMR]
HP1 chromo shadow domain in complex with PXVXL motif of CAF-1 [SOLUTION NMR]
Predicted Effect possibly damaging
Transcript: ENSMUST00000018810
AA Change: D90G

PolyPhen 2 Score 0.679 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000018810
Gene: ENSMUSG00000018666
AA Change: D90G

DomainStartEndE-ValueType
CHROMO 20 72 4.55e-20 SMART
low complexity region 86 109 N/A INTRINSIC
Pfam:Chromo_shadow 115 138 8.2e-12 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000079702
AA Change: D90G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000078640
Gene: ENSMUSG00000018666
AA Change: D90G

DomainStartEndE-ValueType
CHROMO 20 72 4.55e-20 SMART
low complexity region 86 109 N/A INTRINSIC
Pfam:Chromo_shadow 115 147 5e-13 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000093943
AA Change: D90G

PolyPhen 2 Score 0.679 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000091475
Gene: ENSMUSG00000018666
AA Change: D90G

DomainStartEndE-ValueType
CHROMO 20 72 4.55e-20 SMART
low complexity region 86 109 N/A INTRINSIC
ChSh 111 173 4.83e-33 SMART
CHROMO 116 168 1.08e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000134585
AA Change: D90G

PolyPhen 2 Score 0.679 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000137834
Gene: ENSMUSG00000018666
AA Change: D90G

DomainStartEndE-ValueType
CHROMO 20 72 4.55e-20 SMART
low complexity region 86 109 N/A INTRINSIC
Pfam:Chromo_shadow 115 138 8.2e-12 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a highly conserved nonhistone protein, which is a member of the heterochromatin protein family . The protein is enriched in the heterochromatin and associated with centromeres. The protein has a single N-terminal chromodomain which can bind to histone proteins via methylated lysine residues, and a C-terminal chromo shadow-domain (CSD) which is responsible for the homodimerization and interaction with a number of chromatin-associated nonhistone proteins. The protein may play an important role in the epigenetic control of chromatin structure and gene expression. Several related pseudogenes are located on chromosomes 1, 3, and X. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: An uncharacterized gene trap insertion does not result in an obvious phenotype during the observation period early in life, although abnormalities may still develop at older age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik A G 4: 42,971,261 D198G probably benign Het
Abca1 T C 4: 53,084,520 M586V probably benign Het
Adam6b G A 12: 113,491,798 R745H possibly damaging Het
Afg3l1 A G 8: 123,493,918 D462G probably damaging Het
Anapc1 T A 2: 128,622,413 Q1721L possibly damaging Het
Arhgap11a T C 2: 113,834,762 Y497C possibly damaging Het
Bcl7b T G 5: 135,179,970 S96A possibly damaging Het
Birc6 T C 17: 74,642,316 V3111A probably damaging Het
Ccdc105 A G 10: 78,752,472 V168A probably damaging Het
Cdkl3 T C 11: 52,032,468 F524S possibly damaging Het
Cops7b G A 1: 86,589,309 G44R probably damaging Het
D130043K22Rik A G 13: 24,899,635 S1028G probably benign Het
Decr1 T A 4: 15,945,351 M1L probably benign Het
Dmtn T C 14: 70,614,948 I167V probably benign Het
Dnah9 A G 11: 65,859,483 L3932P probably damaging Het
Ece1 T A 4: 137,945,141 I365N probably damaging Het
Exo5 T C 4: 120,922,405 T88A probably benign Het
Frem3 T C 8: 80,663,435 Y1772H probably benign Het
Gm11639 T A 11: 105,037,869 M4815K probably benign Het
Gm5160 A G 18: 14,424,874 N3D possibly damaging Het
Gm7138 T A 10: 77,776,883 D21V unknown Het
Gucy2e A G 11: 69,236,116 V177A probably benign Het
Islr C A 9: 58,156,973 G417V unknown Het
Kif13a A T 13: 46,761,337 M1458K possibly damaging Het
Mcm7 T C 5: 138,165,085 D642G possibly damaging Het
Med24 A T 11: 98,705,144 I941N probably damaging Het
Mrgprb8 C T 7: 48,389,228 P216S possibly damaging Het
Myo5c T A 9: 75,242,772 V13D probably damaging Het
N4bp2 T A 5: 65,808,208 I1200K possibly damaging Het
Naip6 G A 13: 100,300,653 T454M possibly damaging Het
Nfkb1 T C 3: 135,589,452 Y877C probably damaging Het
Nolc1 C A 19: 46,083,032 S473R unknown Het
Nop16 A C 13: 54,589,859 probably benign Het
Nr3c2 T C 8: 77,242,463 I959T probably damaging Het
Nup88 T G 11: 70,944,115 K692N probably benign Het
Nvl C A 1: 181,095,054 G818V probably benign Het
Olfr1046 T C 2: 86,216,856 I285V probably damaging Het
Olfr1193 T C 2: 88,678,611 V245A probably benign Het
Olfr1357 G T 10: 78,612,140 T167N probably benign Het
Olfr731 T A 14: 50,237,919 E322V probably benign Het
Olfr732 A G 14: 50,281,779 I158T probably benign Het
Olfr913 A T 9: 38,595,109 D296V probably damaging Het
Plxnc1 G A 10: 94,799,278 S1362L probably damaging Het
Ppfia2 C T 10: 106,858,253 A696V probably damaging Het
Prl A G 13: 27,059,532 Y62C probably damaging Het
Rnf135 A G 11: 80,198,936 D366G probably damaging Het
Rrp8 A G 7: 105,735,037 L86P probably damaging Het
Rsph4a T C 10: 33,909,449 V452A probably damaging Het
Runx2 C A 17: 44,639,683 V410L probably benign Het
Samd9l T C 6: 3,376,665 T199A probably damaging Het
Sik3 T C 9: 46,209,067 S745P probably damaging Het
Slc35e1 T A 8: 72,488,129 S250C probably damaging Het
Snx31 A G 15: 36,537,552 F160S probably damaging Het
Stim2 T A 5: 53,998,915 V11E probably benign Het
Tmem135 G C 7: 89,147,978 L357V probably benign Het
Tox4 T C 14: 52,286,861 S151P probably damaging Het
Trim34b A T 7: 104,336,112 D318V probably damaging Het
Ubtd1 T C 19: 42,033,756 S156P probably damaging Het
Usp34 C A 11: 23,484,143 L3240M Het
Vmn1r56 T C 7: 5,195,806 S271G probably damaging Het
Vps13b T C 15: 35,472,066 probably benign Het
Vps13c T C 9: 67,945,828 F2401S probably damaging Het
Zbtb11 G A 16: 55,982,274 V216I probably damaging Het
Zfp931 T C 2: 178,067,796 T266A possibly damaging Het
Zfp956 A G 6: 47,956,108 M106V probably benign Het
Other mutations in Cbx1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01145:Cbx1 APN 11 96801566 missense probably benign 0.07
IGL02027:Cbx1 APN 11 96801489 missense probably damaging 0.98
IGL03228:Cbx1 APN 11 96800805 utr 5 prime probably benign
R1868:Cbx1 UTSW 11 96802728 missense probably benign 0.18
R6406:Cbx1 UTSW 11 96801538 nonsense probably null
R7696:Cbx1 UTSW 11 96806642 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACTAGGAAAGTCTAGCGATTGG -3'
(R):5'- AGTCCAGTATGGTAGTTCGTACTC -3'

Sequencing Primer
(F):5'- CTAGGAAAGTCTAGCGATTGGTTATC -3'
(R):5'- GCCTAGGCTTCTATGCAAGAC -3'
Posted On2021-04-30