Incidental Mutation 'R8806:Med24'
ID672086
Institutional Source Beutler Lab
Gene Symbol Med24
Ensembl Gene ENSMUSG00000017210
Gene Namemediator complex subunit 24
SynonymsTrap100, 100kDa, Thrap4, Pparb2, R75526, DRIP100, Gse2, D11Ertd307e
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8806 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location98704591-98729435 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 98705144 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 941 (I941N)
Ref Sequence ENSEMBL: ENSMUSP00000017354 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017354] [ENSMUST00000038886] [ENSMUST00000100500] [ENSMUST00000138750]
Predicted Effect probably damaging
Transcript: ENSMUST00000017354
AA Change: I941N

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000017354
Gene: ENSMUSG00000017210
AA Change: I941N

DomainStartEndE-ValueType
Pfam:Med24_N 1 985 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000038886
SMART Domains Protein: ENSMUSP00000037762
Gene: ENSMUSG00000038067

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
low complexity region 31 54 N/A INTRINSIC
IL6 57 205 3.59e-48 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000100500
AA Change: I960N

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000098069
Gene: ENSMUSG00000017210
AA Change: I960N

DomainStartEndE-ValueType
Pfam:Med24_N 1 1004 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138750
SMART Domains Protein: ENSMUSP00000120002
Gene: ENSMUSG00000017210

DomainStartEndE-ValueType
Pfam:Med24_N 1 46 1.4e-26 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a component of the mediator complex (also known as TRAP, SMCC, DRIP, or ARC), a transcriptional coactivator complex thought to be required for the expression of almost all genes. The mediator complex is recruited by transcriptional activators or nuclear receptors to induce gene expression, possibly by interacting with RNA polymerase II and promoting the formation of a transcriptional pre-initiation complex. The product of this gene may form a submodule of the mediator complex that magnifies the effects of activators on the general transcription machinery. Alternatively spliced transcript variants of this gene have been described, but their full-length nature is not known. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice die prior to birth exhibiting abnormal heart development, neural tube defects, and anemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik A G 4: 42,971,261 D198G probably benign Het
Abca1 T C 4: 53,084,520 M586V probably benign Het
Adam6b G A 12: 113,491,798 R745H possibly damaging Het
Afg3l1 A G 8: 123,493,918 D462G probably damaging Het
Anapc1 T A 2: 128,622,413 Q1721L possibly damaging Het
Arhgap11a T C 2: 113,834,762 Y497C possibly damaging Het
Bcl7b T G 5: 135,179,970 S96A possibly damaging Het
Birc6 T C 17: 74,642,316 V3111A probably damaging Het
Cbx1 A G 11: 96,801,557 D90G possibly damaging Het
Ccdc105 A G 10: 78,752,472 V168A probably damaging Het
Cdkl3 T C 11: 52,032,468 F524S possibly damaging Het
Cops7b G A 1: 86,589,309 G44R probably damaging Het
D130043K22Rik A G 13: 24,899,635 S1028G probably benign Het
Decr1 T A 4: 15,945,351 M1L probably benign Het
Dmtn T C 14: 70,614,948 I167V probably benign Het
Dnah9 A G 11: 65,859,483 L3932P probably damaging Het
Ece1 T A 4: 137,945,141 I365N probably damaging Het
Exo5 T C 4: 120,922,405 T88A probably benign Het
Frem3 T C 8: 80,663,435 Y1772H probably benign Het
Gm11639 T A 11: 105,037,869 M4815K probably benign Het
Gm5160 A G 18: 14,424,874 N3D possibly damaging Het
Gm7138 T A 10: 77,776,883 D21V unknown Het
Gucy2e A G 11: 69,236,116 V177A probably benign Het
Islr C A 9: 58,156,973 G417V unknown Het
Kif13a A T 13: 46,761,337 M1458K possibly damaging Het
Mcm7 T C 5: 138,165,085 D642G possibly damaging Het
Mrgprb8 C T 7: 48,389,228 P216S possibly damaging Het
Myo5c T A 9: 75,242,772 V13D probably damaging Het
N4bp2 T A 5: 65,808,208 I1200K possibly damaging Het
Naip6 G A 13: 100,300,653 T454M possibly damaging Het
Nfkb1 T C 3: 135,589,452 Y877C probably damaging Het
Nolc1 C A 19: 46,083,032 S473R unknown Het
Nop16 A C 13: 54,589,859 probably benign Het
Nr3c2 T C 8: 77,242,463 I959T probably damaging Het
Nup88 T G 11: 70,944,115 K692N probably benign Het
Nvl C A 1: 181,095,054 G818V probably benign Het
Olfr1046 T C 2: 86,216,856 I285V probably damaging Het
Olfr1193 T C 2: 88,678,611 V245A probably benign Het
Olfr1357 G T 10: 78,612,140 T167N probably benign Het
Olfr731 T A 14: 50,237,919 E322V probably benign Het
Olfr732 A G 14: 50,281,779 I158T probably benign Het
Olfr913 A T 9: 38,595,109 D296V probably damaging Het
Plxnc1 G A 10: 94,799,278 S1362L probably damaging Het
Ppfia2 C T 10: 106,858,253 A696V probably damaging Het
Prl A G 13: 27,059,532 Y62C probably damaging Het
Rnf135 A G 11: 80,198,936 D366G probably damaging Het
Rrp8 A G 7: 105,735,037 L86P probably damaging Het
Rsph4a T C 10: 33,909,449 V452A probably damaging Het
Runx2 C A 17: 44,639,683 V410L probably benign Het
Samd9l T C 6: 3,376,665 T199A probably damaging Het
Sik3 T C 9: 46,209,067 S745P probably damaging Het
Slc35e1 T A 8: 72,488,129 S250C probably damaging Het
Snx31 A G 15: 36,537,552 F160S probably damaging Het
Stim2 T A 5: 53,998,915 V11E probably benign Het
Tmem135 G C 7: 89,147,978 L357V probably benign Het
Tox4 T C 14: 52,286,861 S151P probably damaging Het
Trim34b A T 7: 104,336,112 D318V probably damaging Het
Ubtd1 T C 19: 42,033,756 S156P probably damaging Het
Usp34 C A 11: 23,484,143 L3240M Het
Vmn1r56 T C 7: 5,195,806 S271G probably damaging Het
Vps13b T C 15: 35,472,066 probably benign Het
Vps13c T C 9: 67,945,828 F2401S probably damaging Het
Zbtb11 G A 16: 55,982,274 V216I probably damaging Het
Zfp931 T C 2: 178,067,796 T266A possibly damaging Het
Zfp956 A G 6: 47,956,108 M106V probably benign Het
Other mutations in Med24
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01942:Med24 APN 11 98709682 missense probably damaging 0.99
IGL01960:Med24 APN 11 98707542 missense probably benign
IGL02119:Med24 APN 11 98728835 missense probably benign 0.14
IGL02681:Med24 APN 11 98709739 nonsense probably null
IGL03038:Med24 APN 11 98716184 missense possibly damaging 0.93
IGL03377:Med24 APN 11 98705136 missense possibly damaging 0.67
R1186:Med24 UTSW 11 98717757 utr 3 prime probably benign
R1887:Med24 UTSW 11 98718816 critical splice donor site probably benign
R1888:Med24 UTSW 11 98707282 utr 3 prime probably benign
R1936:Med24 UTSW 11 98718816 critical splice donor site probably null
R2063:Med24 UTSW 11 98715646 missense probably damaging 0.98
R3895:Med24 UTSW 11 98706388 missense probably benign
R4328:Med24 UTSW 11 98707116 critical splice donor site probably null
R4751:Med24 UTSW 11 98706432 missense probably damaging 0.98
R5195:Med24 UTSW 11 98710281 missense possibly damaging 0.71
R5237:Med24 UTSW 11 98710783 missense probably damaging 0.98
R6047:Med24 UTSW 11 98707765 nonsense probably null
R6834:Med24 UTSW 11 98705024 splice site probably null
R6984:Med24 UTSW 11 98718542 missense possibly damaging 0.51
R7015:Med24 UTSW 11 98718852 missense possibly damaging 0.51
R7244:Med24 UTSW 11 98714397 splice site probably null
R7479:Med24 UTSW 11 98704961 missense possibly damaging 0.52
R7536:Med24 UTSW 11 98712621 missense possibly damaging 0.52
R7594:Med24 UTSW 11 98715097 missense probably damaging 0.98
R7667:Med24 UTSW 11 98713164 missense possibly damaging 0.71
R7745:Med24 UTSW 11 98704967 missense probably damaging 0.98
R8023:Med24 UTSW 11 98718495 critical splice donor site probably null
R8146:Med24 UTSW 11 98718114 missense probably benign 0.08
R8382:Med24 UTSW 11 98717711 missense unknown
R8442:Med24 UTSW 11 98707557 missense probably benign 0.32
Predicted Primers PCR Primer
(F):5'- CTCCTCAGAGTGCAGCAATG -3'
(R):5'- TGTCTAACCTGTTCGAGAACTG -3'

Sequencing Primer
(F):5'- CTGTGATGGCCAGAACAACCTTG -3'
(R):5'- CTAACCTGTTCGAGAACTGTGTGTC -3'
Posted On2021-04-30