Incidental Mutation 'R8806:Efcab3'
ID 672087
Institutional Source Beutler Lab
Gene Symbol Efcab3
Ensembl Gene ENSMUSG00000020690
Gene Name EF-hand calcium binding domain 3
Synonyms Gm11639, Efcab13, 4921510J17Rik, Efcab15, Gm11639
MMRRC Submission 068612-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8806 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 104954418-105008363 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 104928695 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 4815 (M4815K)
Ref Sequence ENSEMBL: ENSMUSP00000148433 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000212287]
AlphaFold Q80X60
Predicted Effect probably benign
Transcript: ENSMUST00000212287
AA Change: M4815K

PolyPhen 2 Score 0.073 (Sensitivity: 0.93; Specificity: 0.84)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.4%
Validation Efficiency 100% (66/66)
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 T C 4: 53,084,520 (GRCm39) M586V probably benign Het
Adam6b G A 12: 113,455,418 (GRCm39) R745H possibly damaging Het
Afg3l1 A G 8: 124,220,657 (GRCm39) D462G probably damaging Het
Anapc1 T A 2: 128,464,333 (GRCm39) Q1721L possibly damaging Het
Arhgap11a T C 2: 113,665,107 (GRCm39) Y497C possibly damaging Het
Bcl7b T G 5: 135,208,824 (GRCm39) S96A possibly damaging Het
Birc6 T C 17: 74,949,311 (GRCm39) V3111A probably damaging Het
Cbx1 A G 11: 96,692,383 (GRCm39) D90G possibly damaging Het
Cdkl3 T C 11: 51,923,295 (GRCm39) F524S possibly damaging Het
Cops7b G A 1: 86,517,031 (GRCm39) G44R probably damaging Het
D130043K22Rik A G 13: 25,083,618 (GRCm39) S1028G probably benign Het
Decr1 T A 4: 15,945,351 (GRCm39) M1L probably benign Het
Dmtn T C 14: 70,852,388 (GRCm39) I167V probably benign Het
Dnah9 A G 11: 65,750,309 (GRCm39) L3932P probably damaging Het
Ece1 T A 4: 137,672,452 (GRCm39) I365N probably damaging Het
Exo5 T C 4: 120,779,602 (GRCm39) T88A probably benign Het
Frem3 T C 8: 81,390,064 (GRCm39) Y1772H probably benign Het
Gm5160 A G 18: 14,557,931 (GRCm39) N3D possibly damaging Het
Gm7138 T A 10: 77,612,717 (GRCm39) D21V unknown Het
Gm7298 C A 6: 121,761,641 (GRCm39) silent Het
Gucy2e A G 11: 69,126,942 (GRCm39) V177A probably benign Het
Islr C A 9: 58,064,256 (GRCm39) G417V unknown Het
Kif13a A T 13: 46,914,813 (GRCm39) M1458K possibly damaging Het
Mcm7 T C 5: 138,163,347 (GRCm39) D642G possibly damaging Het
Med24 A T 11: 98,595,970 (GRCm39) I941N probably damaging Het
Mrgprb8 C T 7: 48,038,976 (GRCm39) P216S possibly damaging Het
Myo5c T A 9: 75,150,054 (GRCm39) V13D probably damaging Het
N4bp2 T A 5: 65,965,551 (GRCm39) I1200K possibly damaging Het
Naip6 G A 13: 100,437,161 (GRCm39) T454M possibly damaging Het
Nfkb1 T C 3: 135,295,213 (GRCm39) Y877C probably damaging Het
Nolc1 C A 19: 46,071,471 (GRCm39) S473R unknown Het
Nop16 A C 13: 54,737,672 (GRCm39) probably benign Het
Nr3c2 T C 8: 77,969,092 (GRCm39) I959T probably damaging Het
Nup88 T G 11: 70,834,941 (GRCm39) K692N probably benign Het
Nvl C A 1: 180,922,619 (GRCm39) G818V probably benign Het
Or1i2 G T 10: 78,447,974 (GRCm39) T167N probably benign Het
Or4k6 T A 14: 50,475,376 (GRCm39) E322V probably benign Het
Or4n4 A G 14: 50,519,236 (GRCm39) I158T probably benign Het
Or4s2b T C 2: 88,508,955 (GRCm39) V245A probably benign Het
Or8b49 A T 9: 38,506,405 (GRCm39) D296V probably damaging Het
Or8k1 T C 2: 86,047,200 (GRCm39) I285V probably damaging Het
Plxnc1 G A 10: 94,635,140 (GRCm39) S1362L probably damaging Het
Ppfia2 C T 10: 106,694,114 (GRCm39) A696V probably damaging Het
Prl A G 13: 27,243,515 (GRCm39) Y62C probably damaging Het
Rnf135 A G 11: 80,089,762 (GRCm39) D366G probably damaging Het
Rrp8 A G 7: 105,384,244 (GRCm39) L86P probably damaging Het
Rsph4a T C 10: 33,785,445 (GRCm39) V452A probably damaging Het
Runx2 C A 17: 44,950,570 (GRCm39) V410L probably benign Het
Samd9l T C 6: 3,376,665 (GRCm39) T199A probably damaging Het
Sik3 T C 9: 46,120,365 (GRCm39) S745P probably damaging Het
Slc35e1 T A 8: 73,241,973 (GRCm39) S250C probably damaging Het
Snx31 A G 15: 36,537,698 (GRCm39) F160S probably damaging Het
Spata31g1 A G 4: 42,971,261 (GRCm39) D198G probably benign Het
Stim2 T A 5: 54,156,257 (GRCm39) V11E probably benign Het
Tektl1 A G 10: 78,588,306 (GRCm39) V168A probably damaging Het
Tmem135 G C 7: 88,797,186 (GRCm39) L357V probably benign Het
Tox4 T C 14: 52,524,318 (GRCm39) S151P probably damaging Het
Trim34b A T 7: 103,985,319 (GRCm39) D318V probably damaging Het
Ubtd1 T C 19: 42,022,195 (GRCm39) S156P probably damaging Het
Usp34 C A 11: 23,434,143 (GRCm39) L3240M Het
Vmn1r56 T C 7: 5,198,805 (GRCm39) S271G probably damaging Het
Vps13b T C 15: 35,472,212 (GRCm39) probably benign Het
Vps13c T C 9: 67,853,110 (GRCm39) F2401S probably damaging Het
Zbtb11 G A 16: 55,802,637 (GRCm39) V216I probably damaging Het
Zfp931 T C 2: 177,709,589 (GRCm39) T266A possibly damaging Het
Zfp956 A G 6: 47,933,042 (GRCm39) M106V probably benign Het
Other mutations in Efcab3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00897:Efcab3 APN 11 104,990,847 (GRCm39) missense probably damaging 1.00
IGL01308:Efcab3 APN 11 104,611,523 (GRCm39) missense probably benign 0.03
IGL01483:Efcab3 APN 11 104,630,173 (GRCm39) missense probably benign 0.03
IGL01695:Efcab3 APN 11 104,626,889 (GRCm39) missense probably damaging 1.00
IGL01860:Efcab3 APN 11 104,581,747 (GRCm39) missense probably benign 0.16
IGL01981:Efcab3 APN 11 104,612,258 (GRCm39) intron probably benign
IGL01984:Efcab3 APN 11 104,629,134 (GRCm39) missense probably benign 0.20
IGL02023:Efcab3 APN 11 104,612,258 (GRCm39) intron probably benign
IGL02252:Efcab3 APN 11 104,644,753 (GRCm39) missense possibly damaging 0.68
IGL02886:Efcab3 APN 11 104,986,700 (GRCm39) missense possibly damaging 0.95
IGL03116:Efcab3 APN 11 104,612,359 (GRCm39) missense probably benign 0.02
IGL03141:Efcab3 APN 11 104,986,696 (GRCm39) missense probably damaging 0.99
IGL03242:Efcab3 APN 11 104,997,230 (GRCm39) missense probably damaging 1.00
IGL03274:Efcab3 APN 11 104,611,919 (GRCm39) missense probably benign 0.03
IGL03408:Efcab3 APN 11 104,601,447 (GRCm39) missense probably benign 0.03
PIT4812001:Efcab3 UTSW 11 104,990,805 (GRCm39) missense probably null 0.00
R0018:Efcab3 UTSW 11 104,612,378 (GRCm39) critical splice donor site probably null
R0068:Efcab3 UTSW 11 104,611,648 (GRCm39) missense probably benign 0.29
R0350:Efcab3 UTSW 11 104,581,706 (GRCm39) missense probably benign 0.03
R0388:Efcab3 UTSW 11 105,000,227 (GRCm39) missense possibly damaging 0.61
R0646:Efcab3 UTSW 11 104,611,327 (GRCm39) missense probably benign 0.03
R0668:Efcab3 UTSW 11 104,611,318 (GRCm39) missense probably benign 0.16
R0715:Efcab3 UTSW 11 104,611,706 (GRCm39) missense possibly damaging 0.90
R0944:Efcab3 UTSW 11 104,601,556 (GRCm39) splice site probably null
R1330:Efcab3 UTSW 11 104,637,116 (GRCm39) missense possibly damaging 0.84
R1440:Efcab3 UTSW 11 104,999,581 (GRCm39) splice site probably benign
R1508:Efcab3 UTSW 11 104,601,503 (GRCm39) missense probably benign 0.03
R1540:Efcab3 UTSW 11 104,999,726 (GRCm39) missense probably benign 0.07
R1643:Efcab3 UTSW 11 104,589,804 (GRCm39) missense probably benign 0.16
R1651:Efcab3 UTSW 11 104,611,492 (GRCm39) missense probably benign 0.03
R1665:Efcab3 UTSW 11 104,611,940 (GRCm39) missense probably benign 0.07
R1702:Efcab3 UTSW 11 104,581,832 (GRCm39) missense probably benign 0.03
R1711:Efcab3 UTSW 11 104,611,514 (GRCm39) missense probably benign 0.07
R1779:Efcab3 UTSW 11 104,611,765 (GRCm39) missense probably benign 0.15
R1813:Efcab3 UTSW 11 104,611,514 (GRCm39) missense probably benign 0.07
R1818:Efcab3 UTSW 11 104,612,333 (GRCm39) missense probably benign 0.10
R1896:Efcab3 UTSW 11 104,611,514 (GRCm39) missense probably benign 0.07
R1969:Efcab3 UTSW 11 104,637,090 (GRCm39) missense probably damaging 1.00
R2029:Efcab3 UTSW 11 104,990,851 (GRCm39) missense probably damaging 0.99
R2139:Efcab3 UTSW 11 104,642,737 (GRCm39) missense possibly damaging 0.53
R2165:Efcab3 UTSW 11 104,642,688 (GRCm39) missense possibly damaging 0.93
R2359:Efcab3 UTSW 11 104,630,106 (GRCm39) missense possibly damaging 0.80
R2394:Efcab3 UTSW 11 104,629,121 (GRCm39) missense probably benign 0.17
R2401:Efcab3 UTSW 11 104,963,144 (GRCm39) critical splice donor site probably null
R2406:Efcab3 UTSW 11 104,611,457 (GRCm39) missense probably benign 0.03
R2570:Efcab3 UTSW 11 104,624,490 (GRCm39) missense probably damaging 1.00
R3795:Efcab3 UTSW 11 104,624,501 (GRCm39) missense possibly damaging 0.94
R3901:Efcab3 UTSW 11 104,974,713 (GRCm39) missense possibly damaging 0.68
R4244:Efcab3 UTSW 11 105,002,629 (GRCm39) missense probably damaging 1.00
R4352:Efcab3 UTSW 11 104,630,140 (GRCm39) missense probably null 0.25
R4359:Efcab3 UTSW 11 104,624,547 (GRCm39) splice site probably null
R4424:Efcab3 UTSW 11 104,626,940 (GRCm39) critical splice donor site probably null
R4895:Efcab3 UTSW 11 105,008,227 (GRCm39) unclassified probably benign
R4895:Efcab3 UTSW 11 104,640,496 (GRCm39) missense probably damaging 1.00
R4895:Efcab3 UTSW 11 104,611,112 (GRCm39) missense probably benign 0.16
R5006:Efcab3 UTSW 11 104,620,503 (GRCm39) splice site probably null
R5066:Efcab3 UTSW 11 104,611,490 (GRCm39) missense probably benign 0.03
R5316:Efcab3 UTSW 11 104,967,286 (GRCm39) missense possibly damaging 0.80
R5329:Efcab3 UTSW 11 104,644,632 (GRCm39) splice site probably null
R5405:Efcab3 UTSW 11 104,612,018 (GRCm39) missense probably benign 0.07
R5814:Efcab3 UTSW 11 104,626,940 (GRCm39) critical splice donor site probably benign
R5888:Efcab3 UTSW 11 104,612,227 (GRCm39) splice site probably benign
R5910:Efcab3 UTSW 11 104,581,760 (GRCm39) missense probably benign 0.01
R5975:Efcab3 UTSW 11 104,578,375 (GRCm39) start gained probably benign
R6019:Efcab3 UTSW 11 104,933,728 (GRCm39) critical splice donor site probably null
R6028:Efcab3 UTSW 11 104,660,481 (GRCm39) critical splice donor site probably null
R6048:Efcab3 UTSW 11 104,835,259 (GRCm39) missense unknown
R6059:Efcab3 UTSW 11 104,927,595 (GRCm39) missense probably benign 0.03
R6147:Efcab3 UTSW 11 104,858,566 (GRCm39) missense unknown
R6176:Efcab3 UTSW 11 104,683,383 (GRCm39) missense probably benign 0.16
R6181:Efcab3 UTSW 11 104,722,159 (GRCm39) missense probably benign 0.25
R6196:Efcab3 UTSW 11 104,746,386 (GRCm39) missense probably benign 0.07
R6245:Efcab3 UTSW 11 104,675,834 (GRCm39) missense probably benign 0.03
R6262:Efcab3 UTSW 11 104,784,579 (GRCm39) missense probably benign 0.24
R6263:Efcab3 UTSW 11 104,810,312 (GRCm39) missense unknown
R6277:Efcab3 UTSW 11 104,901,148 (GRCm39) missense possibly damaging 0.49
R6338:Efcab3 UTSW 11 104,734,034 (GRCm39) nonsense probably null
R6355:Efcab3 UTSW 11 104,896,511 (GRCm39) missense probably benign 0.29
R6356:Efcab3 UTSW 11 104,784,533 (GRCm39) missense probably benign 0.19
R6365:Efcab3 UTSW 11 104,815,412 (GRCm39) missense unknown
R6378:Efcab3 UTSW 11 104,999,620 (GRCm39) missense possibly damaging 0.83
R6391:Efcab3 UTSW 11 104,885,143 (GRCm39) missense possibly damaging 0.92
R6494:Efcab3 UTSW 11 104,990,845 (GRCm39) missense possibly damaging 0.93
R6556:Efcab3 UTSW 11 104,899,077 (GRCm39) missense probably null 0.03
R6573:Efcab3 UTSW 11 104,971,461 (GRCm39) missense possibly damaging 0.91
R6604:Efcab3 UTSW 11 104,589,772 (GRCm39) nonsense probably null
R6605:Efcab3 UTSW 11 104,890,107 (GRCm39) splice site probably null
R6634:Efcab3 UTSW 11 104,784,609 (GRCm39) missense probably benign 0.17
R6723:Efcab3 UTSW 11 105,007,906 (GRCm39) missense possibly damaging 0.95
R6851:Efcab3 UTSW 11 104,896,521 (GRCm39) missense probably benign 0.03
R6862:Efcab3 UTSW 11 104,612,284 (GRCm39) nonsense probably null
R6949:Efcab3 UTSW 11 104,799,896 (GRCm39) missense probably damaging 1.00
R6970:Efcab3 UTSW 11 104,667,182 (GRCm39) missense probably benign 0.03
R7014:Efcab3 UTSW 11 104,584,248 (GRCm39) missense probably benign 0.03
R7097:Efcab3 UTSW 11 104,899,787 (GRCm39) missense possibly damaging 0.68
R7122:Efcab3 UTSW 11 104,899,787 (GRCm39) missense possibly damaging 0.68
R7124:Efcab3 UTSW 11 104,629,100 (GRCm39) missense probably benign 0.17
R7146:Efcab3 UTSW 11 104,913,764 (GRCm39) missense probably benign 0.03
R7146:Efcab3 UTSW 11 104,858,578 (GRCm39) missense unknown
R7154:Efcab3 UTSW 11 104,589,966 (GRCm39) splice site probably null
R7175:Efcab3 UTSW 11 104,838,237 (GRCm39) missense unknown
R7189:Efcab3 UTSW 11 104,986,690 (GRCm39) missense probably benign
R7198:Efcab3 UTSW 11 104,642,711 (GRCm39) missense probably benign 0.15
R7211:Efcab3 UTSW 11 104,601,539 (GRCm39) missense probably benign 0.01
R7211:Efcab3 UTSW 11 104,615,435 (GRCm39) critical splice donor site probably null
R7216:Efcab3 UTSW 11 104,771,375 (GRCm39) missense possibly damaging 0.49
R7221:Efcab3 UTSW 11 104,791,432 (GRCm39) missense probably benign 0.36
R7233:Efcab3 UTSW 11 104,730,669 (GRCm39) missense possibly damaging 0.69
R7236:Efcab3 UTSW 11 104,790,093 (GRCm39) missense probably benign 0.10
R7262:Efcab3 UTSW 11 104,745,432 (GRCm39) critical splice donor site probably null
R7289:Efcab3 UTSW 11 104,929,184 (GRCm39) missense probably benign 0.24
R7323:Efcab3 UTSW 11 104,920,837 (GRCm39) missense probably benign 0.07
R7378:Efcab3 UTSW 11 104,605,528 (GRCm39) missense probably benign 0.03
R7388:Efcab3 UTSW 11 104,611,871 (GRCm39) missense probably damaging 0.97
R7390:Efcab3 UTSW 11 104,615,411 (GRCm39) missense possibly damaging 0.46
R7411:Efcab3 UTSW 11 104,890,549 (GRCm39) missense probably benign 0.10
R7468:Efcab3 UTSW 11 104,640,526 (GRCm39) missense probably benign 0.17
R7483:Efcab3 UTSW 11 105,000,112 (GRCm39) missense probably benign 0.39
R7497:Efcab3 UTSW 11 104,653,516 (GRCm39) critical splice donor site probably null
R7612:Efcab3 UTSW 11 104,999,647 (GRCm39) missense possibly damaging 0.80
R7620:Efcab3 UTSW 11 104,722,969 (GRCm39) missense possibly damaging 0.95
R7638:Efcab3 UTSW 11 104,927,625 (GRCm39) missense probably benign 0.03
R7661:Efcab3 UTSW 11 104,617,503 (GRCm39) missense probably benign 0.03
R7667:Efcab3 UTSW 11 104,642,737 (GRCm39) missense possibly damaging 0.53
R7682:Efcab3 UTSW 11 104,855,174 (GRCm39) splice site probably null
R7708:Efcab3 UTSW 11 104,855,397 (GRCm39) missense unknown
R7719:Efcab3 UTSW 11 105,002,674 (GRCm39) missense probably benign 0.14
R7721:Efcab3 UTSW 11 104,615,366 (GRCm39) nonsense probably null
R7735:Efcab3 UTSW 11 104,962,465 (GRCm39) missense probably benign
R7747:Efcab3 UTSW 11 104,733,429 (GRCm39) missense probably damaging 0.96
R7840:Efcab3 UTSW 11 104,624,539 (GRCm39) missense probably benign 0.07
R7846:Efcab3 UTSW 11 104,605,571 (GRCm39) critical splice donor site probably null
R7893:Efcab3 UTSW 11 104,870,186 (GRCm39) missense unknown
R7895:Efcab3 UTSW 11 105,008,150 (GRCm39) missense probably benign 0.29
R7897:Efcab3 UTSW 11 104,889,061 (GRCm39) missense probably benign 0.24
R7936:Efcab3 UTSW 11 104,890,524 (GRCm39) missense possibly damaging 0.89
R7936:Efcab3 UTSW 11 104,937,385 (GRCm39) critical splice donor site probably null
R7959:Efcab3 UTSW 11 104,933,627 (GRCm39) missense probably damaging 0.96
R8031:Efcab3 UTSW 11 104,772,295 (GRCm39) missense possibly damaging 0.49
R8041:Efcab3 UTSW 11 104,810,305 (GRCm39) missense unknown
R8054:Efcab3 UTSW 11 104,621,226 (GRCm39) missense probably benign 0.07
R8056:Efcab3 UTSW 11 104,799,896 (GRCm39) missense probably damaging 0.98
R8061:Efcab3 UTSW 11 104,997,275 (GRCm39) missense probably benign 0.00
R8088:Efcab3 UTSW 11 104,889,072 (GRCm39) missense probably benign 0.10
R8112:Efcab3 UTSW 11 104,841,026 (GRCm39) missense unknown
R8116:Efcab3 UTSW 11 105,002,677 (GRCm39) missense possibly damaging 0.65
R8340:Efcab3 UTSW 11 104,876,856 (GRCm39) missense unknown
R8405:Efcab3 UTSW 11 104,612,024 (GRCm39) missense probably benign 0.02
R8413:Efcab3 UTSW 11 104,811,135 (GRCm39) missense unknown
R8472:Efcab3 UTSW 11 104,709,463 (GRCm39) missense probably benign 0.07
R8549:Efcab3 UTSW 11 104,890,521 (GRCm39) missense probably damaging 0.99
R8699:Efcab3 UTSW 11 104,672,072 (GRCm39) missense probably benign 0.03
R8711:Efcab3 UTSW 11 104,743,371 (GRCm39) missense probably benign 0.03
R8732:Efcab3 UTSW 11 104,695,100 (GRCm39) missense probably benign 0.03
R8745:Efcab3 UTSW 11 104,749,304 (GRCm39) missense possibly damaging 0.57
R8810:Efcab3 UTSW 11 104,805,721 (GRCm39) missense unknown
R8845:Efcab3 UTSW 11 104,899,787 (GRCm39) missense possibly damaging 0.68
R8870:Efcab3 UTSW 11 104,791,500 (GRCm39) missense probably benign 0.07
R8872:Efcab3 UTSW 11 104,760,880 (GRCm39) missense probably benign 0.19
R8879:Efcab3 UTSW 11 104,581,781 (GRCm39) missense probably benign 0.03
R8924:Efcab3 UTSW 11 104,806,253 (GRCm39) frame shift probably null
R8954:Efcab3 UTSW 11 104,909,525 (GRCm39) critical splice donor site probably null
R8960:Efcab3 UTSW 11 104,820,772 (GRCm39) splice site probably benign
R8975:Efcab3 UTSW 11 104,954,415 (GRCm39) missense probably benign 0.17
R8988:Efcab3 UTSW 11 104,911,352 (GRCm39) missense probably benign 0.07
R8998:Efcab3 UTSW 11 104,640,477 (GRCm39) missense probably benign 0.09
R8999:Efcab3 UTSW 11 104,640,477 (GRCm39) missense probably benign 0.09
R9002:Efcab3 UTSW 11 104,920,822 (GRCm39) missense probably damaging 0.99
R9012:Efcab3 UTSW 11 104,711,347 (GRCm39) critical splice donor site probably null
R9036:Efcab3 UTSW 11 104,927,601 (GRCm39) missense probably benign 0.03
R9037:Efcab3 UTSW 11 104,803,791 (GRCm39) missense unknown
R9059:Efcab3 UTSW 11 104,642,689 (GRCm39) missense possibly damaging 0.73
R9066:Efcab3 UTSW 11 104,631,688 (GRCm39) intron probably benign
R9122:Efcab3 UTSW 11 104,856,605 (GRCm39) missense unknown
R9125:Efcab3 UTSW 11 104,736,360 (GRCm39) missense probably damaging 1.00
R9127:Efcab3 UTSW 11 104,741,407 (GRCm39) missense probably benign 0.07
R9171:Efcab3 UTSW 11 104,800,708 (GRCm39) missense probably benign 0.36
R9219:Efcab3 UTSW 11 104,836,691 (GRCm39) missense unknown
R9224:Efcab3 UTSW 11 104,661,801 (GRCm39) missense probably benign 0.07
R9235:Efcab3 UTSW 11 104,907,987 (GRCm39) missense probably benign 0.19
R9294:Efcab3 UTSW 11 104,722,126 (GRCm39) missense probably benign 0.24
R9318:Efcab3 UTSW 11 104,856,648 (GRCm39) critical splice donor site probably null
R9322:Efcab3 UTSW 11 104,765,199 (GRCm39) missense probably benign 0.36
R9361:Efcab3 UTSW 11 104,896,524 (GRCm39) missense probably benign 0.03
R9408:Efcab3 UTSW 11 104,621,255 (GRCm39) critical splice donor site probably null
R9434:Efcab3 UTSW 11 104,899,863 (GRCm39) missense probably benign 0.24
R9477:Efcab3 UTSW 11 104,836,698 (GRCm39) missense unknown
R9658:Efcab3 UTSW 11 104,611,120 (GRCm39) missense probably benign 0.03
R9719:Efcab3 UTSW 11 104,867,912 (GRCm39) missense unknown
R9751:Efcab3 UTSW 11 104,783,911 (GRCm39) missense probably benign 0.19
R9763:Efcab3 UTSW 11 104,890,485 (GRCm39) missense possibly damaging 0.89
X0026:Efcab3 UTSW 11 105,007,937 (GRCm39) missense probably benign 0.03
X0026:Efcab3 UTSW 11 104,611,801 (GRCm39) missense probably benign 0.07
Z1088:Efcab3 UTSW 11 104,642,728 (GRCm39) missense probably damaging 0.96
Z1176:Efcab3 UTSW 11 104,990,872 (GRCm39) missense probably damaging 1.00
Z1176:Efcab3 UTSW 11 104,892,793 (GRCm39) missense probably benign 0.29
Z1176:Efcab3 UTSW 11 104,999,598 (GRCm39) nonsense probably null
Z1177:Efcab3 UTSW 11 104,711,344 (GRCm39) missense probably benign 0.03
Z1177:Efcab3 UTSW 11 104,630,164 (GRCm39) nonsense probably null
Z1177:Efcab3 UTSW 11 104,814,845 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- TGTCTGCTAAGGGTGGAAGA -3'
(R):5'- ACCACACTGGAAAACCATGTTT -3'

Sequencing Primer
(F):5'- CCATCTGTCCACCATTTTTCAATTAG -3'
(R):5'- AAACCATGTTTTCCCAGGTTGTG -3'
Posted On 2021-04-30