Incidental Mutation 'R8806:D130043K22Rik'
ID672089
Institutional Source Beutler Lab
Gene Symbol D130043K22Rik
Ensembl Gene ENSMUSG00000006711
Gene NameRIKEN cDNA D130043K22 gene
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8806 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location24845135-24901270 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 24899635 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 1028 (S1028G)
Ref Sequence ENSEMBL: ENSMUSP00000006893 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006893] [ENSMUST00000141572]
Predicted Effect probably benign
Transcript: ENSMUST00000006893
AA Change: S1028G

PolyPhen 2 Score 0.113 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000006893
Gene: ENSMUSG00000006711
AA Change: S1028G

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Blast:MANEC 23 102 3e-44 BLAST
low complexity region 236 270 N/A INTRINSIC
FN3 332 427 3.43e1 SMART
PKD 345 436 3.96e0 SMART
FN3 435 521 3.08e1 SMART
PKD 444 533 7.12e-10 SMART
PKD 539 629 1.46e-6 SMART
PKD 630 723 6.75e-11 SMART
FN3 634 711 5.1e1 SMART
FN3 728 808 9.15e1 SMART
PKD 729 820 4.38e-10 SMART
transmembrane domain 965 987 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000141572
SMART Domains Protein: ENSMUSP00000116004
Gene: ENSMUSG00000006711

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Blast:MANEC 23 102 2e-44 BLAST
low complexity region 236 270 N/A INTRINSIC
FN3 332 427 3.43e1 SMART
PKD 345 436 3.96e0 SMART
FN3 435 521 3.08e1 SMART
PKD 444 533 7.12e-10 SMART
PKD 539 629 1.46e-6 SMART
PKD 630 723 6.75e-11 SMART
FN3 634 711 5.1e1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a transmembrane protein that contains a large extracellular domain with multiple polycystic kidney disease (PKD) domains. The encoded protein may play a role in the development of the cerebral cortex by regulating neuronal migration and cell adhesion. Single nucleotide polymorphisms in a similar gene in human are associated with dyslexia. Alternatively spliced transcript variants have been identifed. [provided by RefSeq, May 2015]
PHENOTYPE: Homozygous knockout results in a mild behavioral phenotype: increased prepulse inhibition in males under certain conditions and decreased anxiety-related response. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik A G 4: 42,971,261 D198G probably benign Het
Abca1 T C 4: 53,084,520 M586V probably benign Het
Adam6b G A 12: 113,491,798 R745H possibly damaging Het
Afg3l1 A G 8: 123,493,918 D462G probably damaging Het
Anapc1 T A 2: 128,622,413 Q1721L possibly damaging Het
Arhgap11a T C 2: 113,834,762 Y497C possibly damaging Het
Bcl7b T G 5: 135,179,970 S96A possibly damaging Het
Birc6 T C 17: 74,642,316 V3111A probably damaging Het
Cbx1 A G 11: 96,801,557 D90G possibly damaging Het
Ccdc105 A G 10: 78,752,472 V168A probably damaging Het
Cdkl3 T C 11: 52,032,468 F524S possibly damaging Het
Cops7b G A 1: 86,589,309 G44R probably damaging Het
Decr1 T A 4: 15,945,351 M1L probably benign Het
Dmtn T C 14: 70,614,948 I167V probably benign Het
Dnah9 A G 11: 65,859,483 L3932P probably damaging Het
Ece1 T A 4: 137,945,141 I365N probably damaging Het
Exo5 T C 4: 120,922,405 T88A probably benign Het
Frem3 T C 8: 80,663,435 Y1772H probably benign Het
Gm11639 T A 11: 105,037,869 M4815K probably benign Het
Gm5160 A G 18: 14,424,874 N3D possibly damaging Het
Gm7138 T A 10: 77,776,883 D21V unknown Het
Gucy2e A G 11: 69,236,116 V177A probably benign Het
Islr C A 9: 58,156,973 G417V unknown Het
Kif13a A T 13: 46,761,337 M1458K possibly damaging Het
Mcm7 T C 5: 138,165,085 D642G possibly damaging Het
Med24 A T 11: 98,705,144 I941N probably damaging Het
Mrgprb8 C T 7: 48,389,228 P216S possibly damaging Het
Myo5c T A 9: 75,242,772 V13D probably damaging Het
N4bp2 T A 5: 65,808,208 I1200K possibly damaging Het
Naip6 G A 13: 100,300,653 T454M possibly damaging Het
Nfkb1 T C 3: 135,589,452 Y877C probably damaging Het
Nolc1 C A 19: 46,083,032 S473R unknown Het
Nop16 A C 13: 54,589,859 probably benign Het
Nr3c2 T C 8: 77,242,463 I959T probably damaging Het
Nup88 T G 11: 70,944,115 K692N probably benign Het
Nvl C A 1: 181,095,054 G818V probably benign Het
Olfr1046 T C 2: 86,216,856 I285V probably damaging Het
Olfr1193 T C 2: 88,678,611 V245A probably benign Het
Olfr1357 G T 10: 78,612,140 T167N probably benign Het
Olfr731 T A 14: 50,237,919 E322V probably benign Het
Olfr732 A G 14: 50,281,779 I158T probably benign Het
Olfr913 A T 9: 38,595,109 D296V probably damaging Het
Plxnc1 G A 10: 94,799,278 S1362L probably damaging Het
Ppfia2 C T 10: 106,858,253 A696V probably damaging Het
Prl A G 13: 27,059,532 Y62C probably damaging Het
Rnf135 A G 11: 80,198,936 D366G probably damaging Het
Rrp8 A G 7: 105,735,037 L86P probably damaging Het
Rsph4a T C 10: 33,909,449 V452A probably damaging Het
Runx2 C A 17: 44,639,683 V410L probably benign Het
Samd9l T C 6: 3,376,665 T199A probably damaging Het
Sik3 T C 9: 46,209,067 S745P probably damaging Het
Slc35e1 T A 8: 72,488,129 S250C probably damaging Het
Snx31 A G 15: 36,537,552 F160S probably damaging Het
Stim2 T A 5: 53,998,915 V11E probably benign Het
Tmem135 G C 7: 89,147,978 L357V probably benign Het
Tox4 T C 14: 52,286,861 S151P probably damaging Het
Trim34b A T 7: 104,336,112 D318V probably damaging Het
Ubtd1 T C 19: 42,033,756 S156P probably damaging Het
Usp34 C A 11: 23,484,143 L3240M Het
Vmn1r56 T C 7: 5,195,806 S271G probably damaging Het
Vps13b T C 15: 35,472,066 probably benign Het
Vps13c T C 9: 67,945,828 F2401S probably damaging Het
Zbtb11 G A 16: 55,982,274 V216I probably damaging Het
Zfp931 T C 2: 178,067,796 T266A possibly damaging Het
Zfp956 A G 6: 47,956,108 M106V probably benign Het
Other mutations in D130043K22Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00850:D130043K22Rik APN 13 24867174 missense probably damaging 1.00
IGL01114:D130043K22Rik APN 13 24857156 missense probably damaging 0.99
IGL01412:D130043K22Rik APN 13 24887860 missense probably damaging 1.00
IGL01542:D130043K22Rik APN 13 24876037 splice site probably null
IGL01615:D130043K22Rik APN 13 24899796 missense probably damaging 1.00
IGL01705:D130043K22Rik APN 13 24857941 missense probably benign 0.00
IGL02220:D130043K22Rik APN 13 24883755 missense possibly damaging 0.95
IGL02229:D130043K22Rik APN 13 24875924 missense probably damaging 1.00
IGL02576:D130043K22Rik APN 13 24856870 missense possibly damaging 0.74
IGL03038:D130043K22Rik APN 13 24879619 missense probably damaging 1.00
IGL03117:D130043K22Rik APN 13 24889842 missense probably damaging 1.00
IGL03014:D130043K22Rik UTSW 13 24858092 missense possibly damaging 0.88
R0019:D130043K22Rik UTSW 13 24880812 missense probably damaging 1.00
R0019:D130043K22Rik UTSW 13 24880812 missense probably damaging 1.00
R0020:D130043K22Rik UTSW 13 24854492 utr 5 prime probably benign
R0172:D130043K22Rik UTSW 13 24872406 missense probably benign 0.16
R0276:D130043K22Rik UTSW 13 24858045 missense possibly damaging 0.92
R0304:D130043K22Rik UTSW 13 24864815 missense probably benign 0.07
R0335:D130043K22Rik UTSW 13 24887877 missense probably damaging 0.98
R0744:D130043K22Rik UTSW 13 24863580 splice site probably benign
R0833:D130043K22Rik UTSW 13 24863580 splice site probably benign
R0836:D130043K22Rik UTSW 13 24863580 splice site probably benign
R1270:D130043K22Rik UTSW 13 24857338 missense probably benign 0.00
R1433:D130043K22Rik UTSW 13 24871341 missense probably damaging 1.00
R1682:D130043K22Rik UTSW 13 24882556 missense probably damaging 1.00
R1772:D130043K22Rik UTSW 13 24875999 missense probably damaging 1.00
R1773:D130043K22Rik UTSW 13 24882602 missense possibly damaging 0.80
R1800:D130043K22Rik UTSW 13 24883894 missense probably damaging 1.00
R1956:D130043K22Rik UTSW 13 24885595 missense probably damaging 1.00
R2255:D130043K22Rik UTSW 13 24856911 missense probably damaging 1.00
R2445:D130043K22Rik UTSW 13 24857036 missense probably benign 0.04
R2568:D130043K22Rik UTSW 13 24883891 missense probably damaging 0.97
R4160:D130043K22Rik UTSW 13 24862696 missense probably benign 0.02
R4494:D130043K22Rik UTSW 13 24871356 missense probably benign 0.16
R4732:D130043K22Rik UTSW 13 24899665 missense probably damaging 1.00
R4733:D130043K22Rik UTSW 13 24899665 missense probably damaging 1.00
R4782:D130043K22Rik UTSW 13 24878040 missense probably damaging 1.00
R4799:D130043K22Rik UTSW 13 24878040 missense probably damaging 1.00
R4864:D130043K22Rik UTSW 13 24863612 missense probably damaging 1.00
R5155:D130043K22Rik UTSW 13 24872290 missense probably damaging 1.00
R5240:D130043K22Rik UTSW 13 24877977 missense probably damaging 1.00
R5383:D130043K22Rik UTSW 13 24857414 missense probably benign 0.02
R5493:D130043K22Rik UTSW 13 24863603 missense probably damaging 1.00
R6184:D130043K22Rik UTSW 13 24885591 missense probably damaging 1.00
R6305:D130043K22Rik UTSW 13 24885685 missense probably damaging 1.00
R6436:D130043K22Rik UTSW 13 24877935 missense probably damaging 1.00
R6980:D130043K22Rik UTSW 13 24864781 missense probably damaging 0.98
R7038:D130043K22Rik UTSW 13 24893408 missense probably damaging 1.00
R7085:D130043K22Rik UTSW 13 24872302 missense possibly damaging 0.95
R7147:D130043K22Rik UTSW 13 24882563 missense probably benign 0.31
R7384:D130043K22Rik UTSW 13 24882605 missense probably damaging 1.00
R7398:D130043K22Rik UTSW 13 24893377 missense probably damaging 0.97
R7584:D130043K22Rik UTSW 13 24872370 missense probably damaging 1.00
R7585:D130043K22Rik UTSW 13 24885585 missense probably benign 0.01
R7588:D130043K22Rik UTSW 13 24887893 missense probably damaging 0.99
R7610:D130043K22Rik UTSW 13 24876002 missense probably benign 0.30
R7903:D130043K22Rik UTSW 13 24876012 missense probably damaging 0.98
R7966:D130043K22Rik UTSW 13 24893423 missense probably damaging 1.00
R8014:D130043K22Rik UTSW 13 24856702 missense probably damaging 1.00
R8374:D130043K22Rik UTSW 13 24857979 missense probably benign 0.07
R8543:D130043K22Rik UTSW 13 24889869 missense probably benign 0.08
R8775:D130043K22Rik UTSW 13 24856999 nonsense probably null
R8775-TAIL:D130043K22Rik UTSW 13 24856999 nonsense probably null
R8916:D130043K22Rik UTSW 13 24872271 missense probably benign
Z1177:D130043K22Rik UTSW 13 24856709 missense probably damaging 1.00
Z1177:D130043K22Rik UTSW 13 24856834 missense probably benign 0.39
Z1177:D130043K22Rik UTSW 13 24872248 missense possibly damaging 0.79
Z1177:D130043K22Rik UTSW 13 24880847 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGTTGACTGACACCTGCAG -3'
(R):5'- TCTGCCTAGTACTGAGCCAC -3'

Sequencing Primer
(F):5'- ACTGACACCTGCAGCCTCTG -3'
(R):5'- GGCTCACAAGGTCTCTCCACAG -3'
Posted On2021-04-30