Incidental Mutation 'R8806:Kif13a'
ID 672091
Institutional Source Beutler Lab
Gene Symbol Kif13a
Ensembl Gene ENSMUSG00000021375
Gene Name kinesin family member 13A
Synonyms 4930505I07Rik, N-3 kinesin
MMRRC Submission 068612-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.268) question?
Stock # R8806 (G1)
Quality Score 225.009
Status Validated
Chromosome 13
Chromosomal Location 46902563-47083343 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 46914813 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 1458 (M1458K)
Ref Sequence ENSEMBL: ENSMUSP00000055304 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056978] [ENSMUST00000223881]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000056978
AA Change: M1458K

PolyPhen 2 Score 0.488 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000055304
Gene: ENSMUSG00000021375
AA Change: M1458K

DomainStartEndE-ValueType
KISc 3 360 2.69e-175 SMART
low complexity region 368 381 N/A INTRINSIC
low complexity region 391 406 N/A INTRINSIC
FHA 469 519 7.16e-2 SMART
coiled coil region 605 639 N/A INTRINSIC
coiled coil region 664 704 N/A INTRINSIC
Pfam:KIF1B 748 792 1.7e-19 PFAM
low complexity region 840 854 N/A INTRINSIC
low complexity region 903 915 N/A INTRINSIC
Pfam:DUF3694 1003 1270 2.2e-39 PFAM
low complexity region 1401 1412 N/A INTRINSIC
low complexity region 1475 1492 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000223881
AA Change: M475K

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.4%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the kinesin family of microtubule-based motor proteins that function in the positioning of endosomes. This family member can direct mannose-6-phosphate receptor-containing vesicles from the trans-Golgi network to the plasma membrane, and it is necessary for the steady-state distribution of late endosomes/lysosomes. It is also required for the translocation of FYVE-CENT and TTC19 from the centrosome to the midbody during cytokinesis, and it plays a role in melanosome maturation. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased anxiety. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 T C 4: 53,084,520 (GRCm39) M586V probably benign Het
Adam6b G A 12: 113,455,418 (GRCm39) R745H possibly damaging Het
Afg3l1 A G 8: 124,220,657 (GRCm39) D462G probably damaging Het
Anapc1 T A 2: 128,464,333 (GRCm39) Q1721L possibly damaging Het
Arhgap11a T C 2: 113,665,107 (GRCm39) Y497C possibly damaging Het
Bcl7b T G 5: 135,208,824 (GRCm39) S96A possibly damaging Het
Birc6 T C 17: 74,949,311 (GRCm39) V3111A probably damaging Het
Cbx1 A G 11: 96,692,383 (GRCm39) D90G possibly damaging Het
Cdkl3 T C 11: 51,923,295 (GRCm39) F524S possibly damaging Het
Cops7b G A 1: 86,517,031 (GRCm39) G44R probably damaging Het
D130043K22Rik A G 13: 25,083,618 (GRCm39) S1028G probably benign Het
Decr1 T A 4: 15,945,351 (GRCm39) M1L probably benign Het
Dmtn T C 14: 70,852,388 (GRCm39) I167V probably benign Het
Dnah9 A G 11: 65,750,309 (GRCm39) L3932P probably damaging Het
Ece1 T A 4: 137,672,452 (GRCm39) I365N probably damaging Het
Efcab3 T A 11: 104,928,695 (GRCm39) M4815K probably benign Het
Exo5 T C 4: 120,779,602 (GRCm39) T88A probably benign Het
Frem3 T C 8: 81,390,064 (GRCm39) Y1772H probably benign Het
Gm5160 A G 18: 14,557,931 (GRCm39) N3D possibly damaging Het
Gm7138 T A 10: 77,612,717 (GRCm39) D21V unknown Het
Gm7298 C A 6: 121,761,641 (GRCm39) silent Het
Gucy2e A G 11: 69,126,942 (GRCm39) V177A probably benign Het
Islr C A 9: 58,064,256 (GRCm39) G417V unknown Het
Mcm7 T C 5: 138,163,347 (GRCm39) D642G possibly damaging Het
Med24 A T 11: 98,595,970 (GRCm39) I941N probably damaging Het
Mrgprb8 C T 7: 48,038,976 (GRCm39) P216S possibly damaging Het
Myo5c T A 9: 75,150,054 (GRCm39) V13D probably damaging Het
N4bp2 T A 5: 65,965,551 (GRCm39) I1200K possibly damaging Het
Naip6 G A 13: 100,437,161 (GRCm39) T454M possibly damaging Het
Nfkb1 T C 3: 135,295,213 (GRCm39) Y877C probably damaging Het
Nolc1 C A 19: 46,071,471 (GRCm39) S473R unknown Het
Nop16 A C 13: 54,737,672 (GRCm39) probably benign Het
Nr3c2 T C 8: 77,969,092 (GRCm39) I959T probably damaging Het
Nup88 T G 11: 70,834,941 (GRCm39) K692N probably benign Het
Nvl C A 1: 180,922,619 (GRCm39) G818V probably benign Het
Or1i2 G T 10: 78,447,974 (GRCm39) T167N probably benign Het
Or4k6 T A 14: 50,475,376 (GRCm39) E322V probably benign Het
Or4n4 A G 14: 50,519,236 (GRCm39) I158T probably benign Het
Or4s2b T C 2: 88,508,955 (GRCm39) V245A probably benign Het
Or8b49 A T 9: 38,506,405 (GRCm39) D296V probably damaging Het
Or8k1 T C 2: 86,047,200 (GRCm39) I285V probably damaging Het
Plxnc1 G A 10: 94,635,140 (GRCm39) S1362L probably damaging Het
Ppfia2 C T 10: 106,694,114 (GRCm39) A696V probably damaging Het
Prl A G 13: 27,243,515 (GRCm39) Y62C probably damaging Het
Rnf135 A G 11: 80,089,762 (GRCm39) D366G probably damaging Het
Rrp8 A G 7: 105,384,244 (GRCm39) L86P probably damaging Het
Rsph4a T C 10: 33,785,445 (GRCm39) V452A probably damaging Het
Runx2 C A 17: 44,950,570 (GRCm39) V410L probably benign Het
Samd9l T C 6: 3,376,665 (GRCm39) T199A probably damaging Het
Sik3 T C 9: 46,120,365 (GRCm39) S745P probably damaging Het
Slc35e1 T A 8: 73,241,973 (GRCm39) S250C probably damaging Het
Snx31 A G 15: 36,537,698 (GRCm39) F160S probably damaging Het
Spata31g1 A G 4: 42,971,261 (GRCm39) D198G probably benign Het
Stim2 T A 5: 54,156,257 (GRCm39) V11E probably benign Het
Tektl1 A G 10: 78,588,306 (GRCm39) V168A probably damaging Het
Tmem135 G C 7: 88,797,186 (GRCm39) L357V probably benign Het
Tox4 T C 14: 52,524,318 (GRCm39) S151P probably damaging Het
Trim34b A T 7: 103,985,319 (GRCm39) D318V probably damaging Het
Ubtd1 T C 19: 42,022,195 (GRCm39) S156P probably damaging Het
Usp34 C A 11: 23,434,143 (GRCm39) L3240M Het
Vmn1r56 T C 7: 5,198,805 (GRCm39) S271G probably damaging Het
Vps13b T C 15: 35,472,212 (GRCm39) probably benign Het
Vps13c T C 9: 67,853,110 (GRCm39) F2401S probably damaging Het
Zbtb11 G A 16: 55,802,637 (GRCm39) V216I probably damaging Het
Zfp931 T C 2: 177,709,589 (GRCm39) T266A possibly damaging Het
Zfp956 A G 6: 47,933,042 (GRCm39) M106V probably benign Het
Other mutations in Kif13a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01084:Kif13a APN 13 46,904,110 (GRCm39) splice site probably benign
IGL01433:Kif13a APN 13 46,926,384 (GRCm39) missense probably damaging 1.00
IGL01528:Kif13a APN 13 47,018,313 (GRCm39) splice site probably benign
IGL01536:Kif13a APN 13 46,905,765 (GRCm39) missense probably damaging 0.96
IGL01620:Kif13a APN 13 47,018,296 (GRCm39) missense probably benign
IGL02020:Kif13a APN 13 46,947,495 (GRCm39) missense probably benign 0.05
IGL02142:Kif13a APN 13 46,925,011 (GRCm39) missense probably benign 0.04
IGL02375:Kif13a APN 13 46,978,698 (GRCm39) missense probably damaging 1.00
IGL02407:Kif13a APN 13 46,938,769 (GRCm39) missense probably damaging 0.99
IGL02476:Kif13a APN 13 46,938,772 (GRCm39) missense probably damaging 1.00
IGL03038:Kif13a APN 13 46,926,314 (GRCm39) missense probably damaging 1.00
IGL03053:Kif13a APN 13 46,905,564 (GRCm39) missense probably benign 0.01
IGL03366:Kif13a APN 13 46,918,099 (GRCm39) missense probably benign 0.00
R0025:Kif13a UTSW 13 46,939,987 (GRCm39) critical splice donor site probably null
R0106:Kif13a UTSW 13 46,978,823 (GRCm39) splice site probably benign
R0106:Kif13a UTSW 13 46,978,823 (GRCm39) splice site probably benign
R0135:Kif13a UTSW 13 46,947,419 (GRCm39) missense probably damaging 0.99
R0137:Kif13a UTSW 13 46,918,079 (GRCm39) missense probably benign 0.38
R0243:Kif13a UTSW 13 46,944,827 (GRCm39) missense probably benign 0.24
R0346:Kif13a UTSW 13 46,967,695 (GRCm39) missense possibly damaging 0.95
R0403:Kif13a UTSW 13 46,944,877 (GRCm39) missense probably damaging 1.00
R0492:Kif13a UTSW 13 46,966,218 (GRCm39) missense possibly damaging 0.93
R0607:Kif13a UTSW 13 46,956,187 (GRCm39) missense probably damaging 0.96
R0631:Kif13a UTSW 13 46,932,364 (GRCm39) unclassified probably benign
R0654:Kif13a UTSW 13 46,966,218 (GRCm39) missense possibly damaging 0.93
R0697:Kif13a UTSW 13 47,001,813 (GRCm39) missense probably benign 0.19
R0699:Kif13a UTSW 13 46,952,689 (GRCm39) missense possibly damaging 0.92
R0715:Kif13a UTSW 13 46,966,299 (GRCm39) missense probably damaging 0.98
R0834:Kif13a UTSW 13 46,967,712 (GRCm39) missense probably damaging 0.96
R0903:Kif13a UTSW 13 47,082,735 (GRCm39) missense possibly damaging 0.75
R1419:Kif13a UTSW 13 46,978,711 (GRCm39) missense probably damaging 1.00
R1428:Kif13a UTSW 13 46,944,987 (GRCm39) splice site probably benign
R1449:Kif13a UTSW 13 46,966,212 (GRCm39) missense probably damaging 1.00
R1463:Kif13a UTSW 13 47,083,088 (GRCm39) missense possibly damaging 0.75
R1541:Kif13a UTSW 13 46,962,689 (GRCm39) missense probably benign
R1579:Kif13a UTSW 13 46,906,332 (GRCm39) missense possibly damaging 0.93
R1582:Kif13a UTSW 13 46,947,398 (GRCm39) missense probably benign 0.03
R1644:Kif13a UTSW 13 46,947,398 (GRCm39) missense probably benign 0.31
R1752:Kif13a UTSW 13 46,951,885 (GRCm39) missense probably damaging 1.00
R1755:Kif13a UTSW 13 46,927,154 (GRCm39) missense possibly damaging 0.50
R1755:Kif13a UTSW 13 46,906,089 (GRCm39) missense possibly damaging 0.73
R1858:Kif13a UTSW 13 47,018,314 (GRCm39) splice site probably benign
R1891:Kif13a UTSW 13 47,082,695 (GRCm39) missense possibly damaging 0.63
R1902:Kif13a UTSW 13 46,941,638 (GRCm39) missense probably benign 0.00
R1928:Kif13a UTSW 13 46,966,221 (GRCm39) missense probably damaging 1.00
R1960:Kif13a UTSW 13 47,018,314 (GRCm39) splice site probably benign
R1961:Kif13a UTSW 13 47,018,314 (GRCm39) splice site probably benign
R2016:Kif13a UTSW 13 46,964,275 (GRCm39) missense probably benign 0.13
R2139:Kif13a UTSW 13 46,905,945 (GRCm39) missense possibly damaging 0.92
R2174:Kif13a UTSW 13 46,922,652 (GRCm39) missense probably damaging 0.99
R2407:Kif13a UTSW 13 46,930,573 (GRCm39) missense probably damaging 1.00
R2504:Kif13a UTSW 13 46,967,676 (GRCm39) missense probably damaging 1.00
R3122:Kif13a UTSW 13 46,918,072 (GRCm39) splice site probably benign
R3499:Kif13a UTSW 13 46,978,815 (GRCm39) missense probably damaging 1.00
R3905:Kif13a UTSW 13 46,956,166 (GRCm39) missense probably damaging 1.00
R4474:Kif13a UTSW 13 46,967,631 (GRCm39) splice site probably null
R4771:Kif13a UTSW 13 46,978,687 (GRCm39) missense probably damaging 1.00
R4838:Kif13a UTSW 13 46,980,224 (GRCm39) missense probably damaging 1.00
R4924:Kif13a UTSW 13 47,083,075 (GRCm39) missense probably damaging 1.00
R4931:Kif13a UTSW 13 46,962,531 (GRCm39) missense probably damaging 0.96
R4980:Kif13a UTSW 13 46,906,222 (GRCm39) missense possibly damaging 0.76
R4992:Kif13a UTSW 13 46,930,639 (GRCm39) missense probably damaging 0.96
R5047:Kif13a UTSW 13 46,941,561 (GRCm39) missense probably benign 0.00
R5054:Kif13a UTSW 13 46,956,122 (GRCm39) missense probably damaging 1.00
R5141:Kif13a UTSW 13 46,906,197 (GRCm39) missense probably benign
R5329:Kif13a UTSW 13 46,928,877 (GRCm39) critical splice donor site probably null
R5429:Kif13a UTSW 13 46,926,245 (GRCm39) critical splice donor site probably null
R5499:Kif13a UTSW 13 46,986,212 (GRCm39) missense probably damaging 1.00
R5509:Kif13a UTSW 13 46,905,591 (GRCm39) missense probably benign 0.13
R5594:Kif13a UTSW 13 46,906,338 (GRCm39) missense probably damaging 1.00
R5921:Kif13a UTSW 13 46,978,776 (GRCm39) missense probably damaging 1.00
R5964:Kif13a UTSW 13 46,925,000 (GRCm39) missense probably damaging 1.00
R6115:Kif13a UTSW 13 46,954,789 (GRCm39) missense probably damaging 1.00
R6317:Kif13a UTSW 13 46,980,233 (GRCm39) missense probably damaging 1.00
R6318:Kif13a UTSW 13 46,968,683 (GRCm39) splice site probably null
R6393:Kif13a UTSW 13 46,905,931 (GRCm39) missense possibly damaging 0.95
R6394:Kif13a UTSW 13 46,905,931 (GRCm39) missense possibly damaging 0.95
R6395:Kif13a UTSW 13 46,905,931 (GRCm39) missense possibly damaging 0.95
R6735:Kif13a UTSW 13 46,906,222 (GRCm39) missense possibly damaging 0.76
R7037:Kif13a UTSW 13 46,905,931 (GRCm39) missense possibly damaging 0.95
R7038:Kif13a UTSW 13 46,905,931 (GRCm39) missense possibly damaging 0.95
R7039:Kif13a UTSW 13 46,905,931 (GRCm39) missense possibly damaging 0.95
R7237:Kif13a UTSW 13 46,962,632 (GRCm39) critical splice donor site probably null
R7285:Kif13a UTSW 13 46,905,931 (GRCm39) missense possibly damaging 0.95
R7286:Kif13a UTSW 13 46,905,931 (GRCm39) missense possibly damaging 0.95
R7287:Kif13a UTSW 13 46,905,931 (GRCm39) missense possibly damaging 0.95
R7341:Kif13a UTSW 13 46,980,221 (GRCm39) missense probably damaging 1.00
R7693:Kif13a UTSW 13 46,904,089 (GRCm39) missense probably benign 0.01
R7761:Kif13a UTSW 13 46,951,955 (GRCm39) missense probably benign
R8098:Kif13a UTSW 13 46,968,780 (GRCm39) missense probably damaging 1.00
R8171:Kif13a UTSW 13 46,932,444 (GRCm39) missense probably damaging 1.00
R8271:Kif13a UTSW 13 46,906,057 (GRCm39) missense probably benign 0.01
R8871:Kif13a UTSW 13 46,984,279 (GRCm39) missense probably damaging 1.00
R8877:Kif13a UTSW 13 46,954,921 (GRCm39) critical splice acceptor site probably null
R8906:Kif13a UTSW 13 46,927,154 (GRCm39) missense probably benign 0.17
R9028:Kif13a UTSW 13 46,951,841 (GRCm39) missense probably damaging 1.00
R9058:Kif13a UTSW 13 46,944,941 (GRCm39) missense probably damaging 1.00
R9062:Kif13a UTSW 13 46,941,536 (GRCm39) missense possibly damaging 0.91
R9070:Kif13a UTSW 13 46,905,934 (GRCm39) missense probably benign 0.00
R9083:Kif13a UTSW 13 46,966,263 (GRCm39) missense probably damaging 1.00
R9250:Kif13a UTSW 13 46,928,909 (GRCm39) missense probably damaging 1.00
R9328:Kif13a UTSW 13 46,951,838 (GRCm39) missense probably damaging 1.00
R9360:Kif13a UTSW 13 46,962,472 (GRCm39) missense probably benign 0.01
R9369:Kif13a UTSW 13 46,940,099 (GRCm39) missense probably damaging 0.99
R9589:Kif13a UTSW 13 46,956,020 (GRCm39) missense probably benign 0.01
R9749:Kif13a UTSW 13 46,914,227 (GRCm39) missense probably damaging 0.96
X0013:Kif13a UTSW 13 47,082,746 (GRCm39) missense possibly damaging 0.49
Predicted Primers PCR Primer
(F):5'- TGCACAATTCCATGCAGCATC -3'
(R):5'- GCATTGATGAAGCTAGCCCC -3'

Sequencing Primer
(F):5'- GCAGCATCCAACACTCGACTG -3'
(R):5'- ATGAAGCTAGCCCCCTCCTG -3'
Posted On 2021-04-30