Incidental Mutation 'R8806:Nop16'
ID672092
Institutional Source Beutler Lab
Gene Symbol Nop16
Ensembl Gene ENSMUSG00000025869
Gene NameNOP16 nucleolar protein
SynonymsD13Wsu177e
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.883) question?
Stock #R8806 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location54584185-54590090 bp(-) (GRCm38)
Type of Mutationcritical splice donor site
DNA Base Change (assembly) A to C at 54589859 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000026987 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026986] [ENSMUST00000026987] [ENSMUST00000049575] [ENSMUST00000091609] [ENSMUST00000140142] [ENSMUST00000148222] [ENSMUST00000149462]
Predicted Effect probably benign
Transcript: ENSMUST00000026986
SMART Domains Protein: ENSMUSP00000026986
Gene: ENSMUSG00000025868

DomainStartEndE-ValueType
Pfam:HIG_1_N 45 96 5.5e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000026987
SMART Domains Protein: ENSMUSP00000026987
Gene: ENSMUSG00000025869

DomainStartEndE-ValueType
Pfam:Nop16 4 157 7.3e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000049575
SMART Domains Protein: ENSMUSP00000053371
Gene: ENSMUSG00000047547

DomainStartEndE-ValueType
Pfam:Clathrin_lg_ch 1 228 2.9e-54 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000091609
SMART Domains Protein: ENSMUSP00000089198
Gene: ENSMUSG00000047547

DomainStartEndE-ValueType
Pfam:Clathrin_lg_ch 1 210 8.7e-70 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000140142
SMART Domains Protein: ENSMUSP00000122336
Gene: ENSMUSG00000047547

DomainStartEndE-ValueType
Pfam:Clathrin_lg_ch 1 95 2.1e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000148222
SMART Domains Protein: ENSMUSP00000122180
Gene: ENSMUSG00000025869

DomainStartEndE-ValueType
Pfam:Nop16 5 88 9.9e-11 PFAM
Pfam:Nop16 67 156 1.6e-19 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000149462
AA Change: *37G
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is localized to the nucleolus. Expression of this gene is induced by estrogens and Myc protein and is a marker of poor patient survival in breast cancer. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik A G 4: 42,971,261 D198G probably benign Het
Abca1 T C 4: 53,084,520 M586V probably benign Het
Adam6b G A 12: 113,491,798 R745H possibly damaging Het
Afg3l1 A G 8: 123,493,918 D462G probably damaging Het
Anapc1 T A 2: 128,622,413 Q1721L possibly damaging Het
Arhgap11a T C 2: 113,834,762 Y497C possibly damaging Het
Bcl7b T G 5: 135,179,970 S96A possibly damaging Het
Birc6 T C 17: 74,642,316 V3111A probably damaging Het
Cbx1 A G 11: 96,801,557 D90G possibly damaging Het
Ccdc105 A G 10: 78,752,472 V168A probably damaging Het
Cdkl3 T C 11: 52,032,468 F524S possibly damaging Het
Cops7b G A 1: 86,589,309 G44R probably damaging Het
D130043K22Rik A G 13: 24,899,635 S1028G probably benign Het
Decr1 T A 4: 15,945,351 M1L probably benign Het
Dmtn T C 14: 70,614,948 I167V probably benign Het
Dnah9 A G 11: 65,859,483 L3932P probably damaging Het
Ece1 T A 4: 137,945,141 I365N probably damaging Het
Exo5 T C 4: 120,922,405 T88A probably benign Het
Frem3 T C 8: 80,663,435 Y1772H probably benign Het
Gm11639 T A 11: 105,037,869 M4815K probably benign Het
Gm5160 A G 18: 14,424,874 N3D possibly damaging Het
Gm7138 T A 10: 77,776,883 D21V unknown Het
Gucy2e A G 11: 69,236,116 V177A probably benign Het
Islr C A 9: 58,156,973 G417V unknown Het
Kif13a A T 13: 46,761,337 M1458K possibly damaging Het
Mcm7 T C 5: 138,165,085 D642G possibly damaging Het
Med24 A T 11: 98,705,144 I941N probably damaging Het
Mrgprb8 C T 7: 48,389,228 P216S possibly damaging Het
Myo5c T A 9: 75,242,772 V13D probably damaging Het
N4bp2 T A 5: 65,808,208 I1200K possibly damaging Het
Naip6 G A 13: 100,300,653 T454M possibly damaging Het
Nfkb1 T C 3: 135,589,452 Y877C probably damaging Het
Nolc1 C A 19: 46,083,032 S473R unknown Het
Nr3c2 T C 8: 77,242,463 I959T probably damaging Het
Nup88 T G 11: 70,944,115 K692N probably benign Het
Nvl C A 1: 181,095,054 G818V probably benign Het
Olfr1046 T C 2: 86,216,856 I285V probably damaging Het
Olfr1193 T C 2: 88,678,611 V245A probably benign Het
Olfr1357 G T 10: 78,612,140 T167N probably benign Het
Olfr731 T A 14: 50,237,919 E322V probably benign Het
Olfr732 A G 14: 50,281,779 I158T probably benign Het
Olfr913 A T 9: 38,595,109 D296V probably damaging Het
Plxnc1 G A 10: 94,799,278 S1362L probably damaging Het
Ppfia2 C T 10: 106,858,253 A696V probably damaging Het
Prl A G 13: 27,059,532 Y62C probably damaging Het
Rnf135 A G 11: 80,198,936 D366G probably damaging Het
Rrp8 A G 7: 105,735,037 L86P probably damaging Het
Rsph4a T C 10: 33,909,449 V452A probably damaging Het
Runx2 C A 17: 44,639,683 V410L probably benign Het
Samd9l T C 6: 3,376,665 T199A probably damaging Het
Sik3 T C 9: 46,209,067 S745P probably damaging Het
Slc35e1 T A 8: 72,488,129 S250C probably damaging Het
Snx31 A G 15: 36,537,552 F160S probably damaging Het
Stim2 T A 5: 53,998,915 V11E probably benign Het
Tmem135 G C 7: 89,147,978 L357V probably benign Het
Tox4 T C 14: 52,286,861 S151P probably damaging Het
Trim34b A T 7: 104,336,112 D318V probably damaging Het
Ubtd1 T C 19: 42,033,756 S156P probably damaging Het
Usp34 C A 11: 23,484,143 L3240M Het
Vmn1r56 T C 7: 5,195,806 S271G probably damaging Het
Vps13b T C 15: 35,472,066 probably benign Het
Vps13c T C 9: 67,945,828 F2401S probably damaging Het
Zbtb11 G A 16: 55,982,274 V216I probably damaging Het
Zfp931 T C 2: 178,067,796 T266A possibly damaging Het
Zfp956 A G 6: 47,956,108 M106V probably benign Het
Other mutations in Nop16
AlleleSourceChrCoordTypePredicted EffectPPH Score
R2300:Nop16 UTSW 13 54585866 splice site probably null
R6913:Nop16 UTSW 13 54589740 missense probably damaging 1.00
R7491:Nop16 UTSW 13 54588604 missense probably benign 0.01
R7515:Nop16 UTSW 13 54589737 missense possibly damaging 0.74
R7810:Nop16 UTSW 13 54590076 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- ACCTTCTTCTTACGGAGGGG -3'
(R):5'- ACGGAGACTATTAACACGCG -3'

Sequencing Primer
(F):5'- GAACCGCCTTGTTGGGGTC -3'
(R):5'- TATTAACACGCGGCTCTGAG -3'
Posted On2021-04-30