Incidental Mutation 'R8806:Nolc1'
ID672105
Institutional Source Beutler Lab
Gene Symbol Nolc1
Ensembl Gene ENSMUSG00000015176
Gene Namenucleolar and coiled-body phosphoprotein 1
SynonymsNOPP140, 3230402K17Rik, P130
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8806 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location46075863-46085530 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 46083032 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 473 (S473R)
Ref Sequence ENSEMBL: ENSMUSP00000128331 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165017] [ENSMUST00000223728] [ENSMUST00000223741] [ENSMUST00000224490] [ENSMUST00000225780]
Predicted Effect unknown
Transcript: ENSMUST00000165017
AA Change: S473R
SMART Domains Protein: ENSMUSP00000128331
Gene: ENSMUSG00000015176
AA Change: S473R

DomainStartEndE-ValueType
LisH 10 42 2.3e-2 SMART
low complexity region 76 100 N/A INTRINSIC
low complexity region 123 187 N/A INTRINSIC
low complexity region 189 210 N/A INTRINSIC
low complexity region 224 272 N/A INTRINSIC
low complexity region 273 285 N/A INTRINSIC
low complexity region 297 313 N/A INTRINSIC
low complexity region 315 328 N/A INTRINSIC
low complexity region 329 342 N/A INTRINSIC
low complexity region 353 383 N/A INTRINSIC
low complexity region 429 470 N/A INTRINSIC
low complexity region 472 486 N/A INTRINSIC
low complexity region 489 501 N/A INTRINSIC
low complexity region 509 538 N/A INTRINSIC
low complexity region 558 579 N/A INTRINSIC
Pfam:SRP40_C 627 699 1.1e-32 PFAM
Predicted Effect
Predicted Effect unknown
Transcript: ENSMUST00000223728
AA Change: S471R
Predicted Effect probably benign
Transcript: ENSMUST00000223741
Predicted Effect probably benign
Transcript: ENSMUST00000224490
Predicted Effect unknown
Transcript: ENSMUST00000225780
AA Change: S472R
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik A G 4: 42,971,261 D198G probably benign Het
Abca1 T C 4: 53,084,520 M586V probably benign Het
Adam6b G A 12: 113,491,798 R745H possibly damaging Het
Afg3l1 A G 8: 123,493,918 D462G probably damaging Het
Anapc1 T A 2: 128,622,413 Q1721L possibly damaging Het
Arhgap11a T C 2: 113,834,762 Y497C possibly damaging Het
Bcl7b T G 5: 135,179,970 S96A possibly damaging Het
Birc6 T C 17: 74,642,316 V3111A probably damaging Het
Cbx1 A G 11: 96,801,557 D90G possibly damaging Het
Ccdc105 A G 10: 78,752,472 V168A probably damaging Het
Cdkl3 T C 11: 52,032,468 F524S possibly damaging Het
Cops7b G A 1: 86,589,309 G44R probably damaging Het
D130043K22Rik A G 13: 24,899,635 S1028G probably benign Het
Decr1 T A 4: 15,945,351 M1L probably benign Het
Dmtn T C 14: 70,614,948 I167V probably benign Het
Dnah9 A G 11: 65,859,483 L3932P probably damaging Het
Ece1 T A 4: 137,945,141 I365N probably damaging Het
Exo5 T C 4: 120,922,405 T88A probably benign Het
Frem3 T C 8: 80,663,435 Y1772H probably benign Het
Gm11639 T A 11: 105,037,869 M4815K probably benign Het
Gm5160 A G 18: 14,424,874 N3D possibly damaging Het
Gm7138 T A 10: 77,776,883 D21V unknown Het
Gucy2e A G 11: 69,236,116 V177A probably benign Het
Islr C A 9: 58,156,973 G417V unknown Het
Kif13a A T 13: 46,761,337 M1458K possibly damaging Het
Mcm7 T C 5: 138,165,085 D642G possibly damaging Het
Med24 A T 11: 98,705,144 I941N probably damaging Het
Mrgprb8 C T 7: 48,389,228 P216S possibly damaging Het
Myo5c T A 9: 75,242,772 V13D probably damaging Het
N4bp2 T A 5: 65,808,208 I1200K possibly damaging Het
Naip6 G A 13: 100,300,653 T454M possibly damaging Het
Nfkb1 T C 3: 135,589,452 Y877C probably damaging Het
Nop16 A C 13: 54,589,859 probably benign Het
Nr3c2 T C 8: 77,242,463 I959T probably damaging Het
Nup88 T G 11: 70,944,115 K692N probably benign Het
Nvl C A 1: 181,095,054 G818V probably benign Het
Olfr1046 T C 2: 86,216,856 I285V probably damaging Het
Olfr1193 T C 2: 88,678,611 V245A probably benign Het
Olfr1357 G T 10: 78,612,140 T167N probably benign Het
Olfr731 T A 14: 50,237,919 E322V probably benign Het
Olfr732 A G 14: 50,281,779 I158T probably benign Het
Olfr913 A T 9: 38,595,109 D296V probably damaging Het
Plxnc1 G A 10: 94,799,278 S1362L probably damaging Het
Ppfia2 C T 10: 106,858,253 A696V probably damaging Het
Prl A G 13: 27,059,532 Y62C probably damaging Het
Rnf135 A G 11: 80,198,936 D366G probably damaging Het
Rrp8 A G 7: 105,735,037 L86P probably damaging Het
Rsph4a T C 10: 33,909,449 V452A probably damaging Het
Runx2 C A 17: 44,639,683 V410L probably benign Het
Samd9l T C 6: 3,376,665 T199A probably damaging Het
Sik3 T C 9: 46,209,067 S745P probably damaging Het
Slc35e1 T A 8: 72,488,129 S250C probably damaging Het
Snx31 A G 15: 36,537,552 F160S probably damaging Het
Stim2 T A 5: 53,998,915 V11E probably benign Het
Tmem135 G C 7: 89,147,978 L357V probably benign Het
Tox4 T C 14: 52,286,861 S151P probably damaging Het
Trim34b A T 7: 104,336,112 D318V probably damaging Het
Ubtd1 T C 19: 42,033,756 S156P probably damaging Het
Usp34 C A 11: 23,484,143 L3240M Het
Vmn1r56 T C 7: 5,195,806 S271G probably damaging Het
Vps13b T C 15: 35,472,066 probably benign Het
Vps13c T C 9: 67,945,828 F2401S probably damaging Het
Zbtb11 G A 16: 55,982,274 V216I probably damaging Het
Zfp931 T C 2: 178,067,796 T266A possibly damaging Het
Zfp956 A G 6: 47,956,108 M106V probably benign Het
Other mutations in Nolc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02679:Nolc1 APN 19 46083029 unclassified probably benign
FR4976:Nolc1 UTSW 19 46081356 small insertion probably benign
FR4976:Nolc1 UTSW 19 46081375 small insertion probably benign
R0106:Nolc1 UTSW 19 46080089 splice site probably benign
R0121:Nolc1 UTSW 19 46081378 unclassified probably benign
R0140:Nolc1 UTSW 19 46081378 unclassified probably benign
R0501:Nolc1 UTSW 19 46078920 missense probably damaging 1.00
R0513:Nolc1 UTSW 19 46084159 missense probably damaging 1.00
R0676:Nolc1 UTSW 19 46080089 splice site probably benign
R1553:Nolc1 UTSW 19 46081375 small insertion probably benign
R1642:Nolc1 UTSW 19 46079022 critical splice donor site probably null
R1698:Nolc1 UTSW 19 46081431 splice site probably null
R2067:Nolc1 UTSW 19 46083607 missense probably damaging 1.00
R2113:Nolc1 UTSW 19 46081359 small insertion probably benign
R2113:Nolc1 UTSW 19 46081361 small insertion probably benign
R2300:Nolc1 UTSW 19 46081359 small insertion probably benign
R2300:Nolc1 UTSW 19 46081368 small insertion probably benign
R2895:Nolc1 UTSW 19 46081352 small insertion probably benign
R2999:Nolc1 UTSW 19 46083155 small deletion probably benign
R3737:Nolc1 UTSW 19 46081353 small insertion probably benign
R3737:Nolc1 UTSW 19 46081370 small insertion probably benign
R3737:Nolc1 UTSW 19 46081377 small insertion probably benign
R3747:Nolc1 UTSW 19 46081356 small insertion probably benign
R3806:Nolc1 UTSW 19 46081352 small insertion probably benign
R3807:Nolc1 UTSW 19 46081352 small insertion probably benign
R3807:Nolc1 UTSW 19 46081359 small insertion probably benign
R3807:Nolc1 UTSW 19 46081371 small insertion probably benign
R4035:Nolc1 UTSW 19 46081358 small insertion probably benign
R4619:Nolc1 UTSW 19 46083520 missense probably damaging 1.00
R4856:Nolc1 UTSW 19 46083155 small deletion probably benign
R4999:Nolc1 UTSW 19 46078920 missense probably damaging 1.00
R5103:Nolc1 UTSW 19 46081664 nonsense probably null
R5559:Nolc1 UTSW 19 46083155 small deletion probably benign
R5837:Nolc1 UTSW 19 46083183 unclassified probably benign
R6457:Nolc1 UTSW 19 46083070 unclassified probably benign
R7467:Nolc1 UTSW 19 46082334 missense unknown
R7497:Nolc1 UTSW 19 46082818 missense probably benign 0.23
R8011:Nolc1 UTSW 19 46081584 missense unknown
RF027:Nolc1 UTSW 19 46081363 small insertion probably benign
RF031:Nolc1 UTSW 19 46081371 small insertion probably benign
RF034:Nolc1 UTSW 19 46081371 small insertion probably benign
RF040:Nolc1 UTSW 19 46081363 small insertion probably benign
RF044:Nolc1 UTSW 19 46081371 small insertion probably benign
X0050:Nolc1 UTSW 19 46081352 small deletion probably benign
Y5377:Nolc1 UTSW 19 46081369 small insertion probably benign
Y5379:Nolc1 UTSW 19 46081359 small insertion probably benign
Z1088:Nolc1 UTSW 19 46083098 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TGCAGGCAGTAACCAGAAAC -3'
(R):5'- GAGAAGCTGGAGTGCCATTG -3'

Sequencing Primer
(F):5'- CCTCAGAGCAGGAAGGCTGAC -3'
(R):5'- GCCATTGGCCTTGCTTGC -3'
Posted On2021-04-30