Incidental Mutation 'R8807:Ifi214'
ID 672110
Institutional Source Beutler Lab
Gene Symbol Ifi214
Ensembl Gene ENSMUSG00000070501
Gene Name interferon activated gene 214
Synonyms BC094916, Pyhin-B
MMRRC Submission 068643-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.058) question?
Stock # R8807 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 173348877-173363523 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 173354133 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 179 (T179I)
Ref Sequence ENSEMBL: ENSMUSP00000115105 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090406] [ENSMUST00000097463] [ENSMUST00000139092]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000090406
AA Change: T179I

PolyPhen 2 Score 0.852 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000087888
Gene: ENSMUSG00000070501
AA Change: T179I

DomainStartEndE-ValueType
PYRIN 6 83 5.01e-17 SMART
low complexity region 152 169 N/A INTRINSIC
Pfam:HIN 231 393 9.1e-71 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000097463
AA Change: T179I

PolyPhen 2 Score 0.852 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000095071
Gene: ENSMUSG00000070501
AA Change: T179I

DomainStartEndE-ValueType
PYRIN 6 83 5.01e-17 SMART
low complexity region 152 169 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000139092
AA Change: T179I

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000115105
Gene: ENSMUSG00000070501
AA Change: T179I

DomainStartEndE-ValueType
PYRIN 6 83 5.01e-17 SMART
low complexity region 152 169 N/A INTRINSIC
Meta Mutation Damage Score 0.1712 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 99% (74/75)
MGI Phenotype FUNCTION: This gene encodes a protein that is a member of the PAAD/DAPIN/Pyrin domain family of proteins. However, compared to the related pyrin and HIN domain family, member 1 (Pyhin1) protein, this protein is C-terminally truncated and lacks a HIN domain, which has an unknown function. It is therefore possible that this gene represents a pseudogene of the Pyhin1 gene, but it is currently being retained as a functional protein-coding gene based on the presence of an intact PAAD/DAPIN/Pyrin domain. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730480H06Rik T C 5: 48,534,494 (GRCm39) I118T probably damaging Het
Abca8a A T 11: 109,974,252 (GRCm39) F227L probably benign Het
Abcc6 A T 7: 45,648,431 (GRCm39) I687N possibly damaging Het
Akain1 T C 17: 69,794,340 (GRCm39) *70Q probably null Het
Allc C T 12: 28,615,489 (GRCm39) G89S probably damaging Het
Aoc1l3 T C 6: 48,965,188 (GRCm39) F399L probably benign Het
Artn A T 4: 117,783,915 (GRCm39) S184T possibly damaging Het
B3galt9 A T 2: 34,728,818 (GRCm39) I206F probably damaging Het
Bcl2a1c A T 9: 114,159,248 (GRCm39) I9F probably damaging Het
Cacna2d1 T A 5: 16,472,452 (GRCm39) D286E probably damaging Het
Cdc25a G A 9: 109,708,303 (GRCm39) E98K probably benign Het
Cdcp3 A T 7: 130,846,507 (GRCm39) I644F probably damaging Het
Cdr2l A T 11: 115,284,741 (GRCm39) Q359L probably damaging Het
Cmip C T 8: 118,138,094 (GRCm39) T103M probably benign Het
Dcaf1 A G 9: 106,742,268 (GRCm39) T1358A probably benign Het
Dedd2 C T 7: 24,910,705 (GRCm39) R157Q probably benign Het
Dhrs1 A G 14: 55,982,499 (GRCm39) V9A probably damaging Het
Dop1b T A 16: 93,558,973 (GRCm39) V573E probably benign Het
Eef2k A T 7: 120,490,930 (GRCm39) I517F possibly damaging Het
En1 T C 1: 120,531,090 (GRCm39) F110S possibly damaging Het
Evpl T A 11: 116,111,853 (GRCm39) I1946F probably damaging Het
Gaa A T 11: 119,168,393 (GRCm39) M502L probably benign Het
Gfer C T 17: 24,914,846 (GRCm39) A66T possibly damaging Het
Gm13271 A G 4: 88,673,213 (GRCm39) T37A probably benign Het
Grm3 C T 5: 9,561,499 (GRCm39) A784T probably damaging Het
H3c8 A G 13: 23,719,628 (GRCm39) K5E probably benign Het
Helz C G 11: 107,493,835 (GRCm39) S277C probably damaging Het
Henmt1 T G 3: 108,867,652 (GRCm39) *396G probably null Het
Hfe C T 13: 23,889,667 (GRCm39) V327I probably benign Het
Hoxd8 A T 2: 74,536,313 (GRCm39) Q141L probably damaging Het
Hspa12b T G 2: 130,987,103 (GRCm39) S675A probably benign Het
Ighv5-9 T A 12: 113,625,404 (GRCm39) Y113F possibly damaging Het
Lca5l T A 16: 95,979,808 (GRCm39) R112S probably benign Het
Lmbrd1 C T 1: 24,770,843 (GRCm39) P257S probably benign Het
Loxhd1 C T 18: 77,444,468 (GRCm39) T608I possibly damaging Het
Lpl C A 8: 69,345,280 (GRCm39) L95I probably damaging Het
Lrp2bp A T 8: 46,473,732 (GRCm39) Q196L probably damaging Het
Ly6h A G 15: 75,438,056 (GRCm39) Y19H probably benign Het
Mfsd6 T C 1: 52,697,706 (GRCm39) probably benign Het
Mpo T C 11: 87,687,165 (GRCm39) I237T probably benign Het
Mrpl41 A G 2: 24,864,878 (GRCm39) W6R unknown Het
Muc16 T A 9: 18,567,353 (GRCm39) H1722L unknown Het
Mug1 A C 6: 121,851,434 (GRCm39) D777A probably benign Het
Myh1 A T 11: 67,111,354 (GRCm39) I1598F probably benign Het
Myo1f C T 17: 33,794,879 (GRCm39) R40C probably damaging Het
Myo6 G A 9: 80,207,949 (GRCm39) probably null Het
Nbeal2 G T 9: 110,458,707 (GRCm39) N2071K probably damaging Het
Nectin4 T A 1: 171,211,282 (GRCm39) C269S probably damaging Het
Nhlrc1 A T 13: 47,167,990 (GRCm39) L89Q probably damaging Het
Nup205 T C 6: 35,160,904 (GRCm39) F103S probably damaging Het
Obscn C A 11: 58,970,470 (GRCm39) V2379F probably damaging Het
Or5m8 A T 2: 85,823,172 (GRCm39) *337L probably null Het
Or5p62 A T 7: 107,771,852 (GRCm39) I33N possibly damaging Het
Plppr2 TCGCC TC 9: 21,855,727 (GRCm39) probably benign Het
Ptbp3 A G 4: 59,517,584 (GRCm39) V101A probably benign Het
Rps6kb2 C T 19: 4,213,229 (GRCm39) D6N probably damaging Het
Rsph1 T A 17: 31,484,828 (GRCm39) H154L probably damaging Het
Sdk1 G A 5: 142,071,382 (GRCm39) V1191M probably damaging Het
Selenos T A 7: 65,729,467 (GRCm39) D2E probably benign Het
Sema5a G A 15: 32,562,868 (GRCm39) G293D possibly damaging Het
Sgcg A G 14: 61,469,930 (GRCm39) S144P probably damaging Het
Sh3d19 T C 3: 85,992,659 (GRCm39) V229A probably benign Het
Sin3b C T 8: 73,476,708 (GRCm39) A714V probably benign Het
Slitrk6 T A 14: 110,988,123 (GRCm39) Q528L possibly damaging Het
Sprr2b CTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCC CTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCC 3: 92,224,826 (GRCm39) probably benign Het
Stard9 T A 2: 120,535,932 (GRCm39) L4063H probably damaging Het
Stard9 A C 2: 120,535,943 (GRCm39) K4067Q probably damaging Het
Terb1 A G 8: 105,195,741 (GRCm39) probably null Het
Tex2 T A 11: 106,435,194 (GRCm39) H744L unknown Het
Tex2 T C 11: 106,458,414 (GRCm39) S339G unknown Het
Tmem135 G C 7: 88,797,186 (GRCm39) L357V probably benign Het
Trhr A T 15: 44,061,212 (GRCm39) N244I probably benign Het
Ttn G A 2: 76,582,409 (GRCm39) A22828V probably damaging Het
Uchl1 C T 5: 66,833,601 (GRCm39) probably benign Het
Uroc1 A T 6: 90,328,110 (GRCm39) I529F probably damaging Het
Vps13c G T 9: 67,766,122 (GRCm39) V80F probably damaging Het
Wnt1 T A 15: 98,690,645 (GRCm39) C325S probably damaging Het
Other mutations in Ifi214
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01413:Ifi214 APN 1 173,356,995 (GRCm39) missense probably damaging 0.99
IGL01418:Ifi214 APN 1 173,356,995 (GRCm39) missense probably damaging 0.99
IGL01821:Ifi214 APN 1 173,356,891 (GRCm39) missense probably damaging 0.97
IGL03341:Ifi214 APN 1 173,354,082 (GRCm39) missense possibly damaging 0.86
PIT4305001:Ifi214 UTSW 1 173,355,485 (GRCm39) missense probably benign 0.00
R1908:Ifi214 UTSW 1 173,357,077 (GRCm39) missense probably benign 0.44
R4239:Ifi214 UTSW 1 173,352,509 (GRCm39) missense possibly damaging 0.92
R4731:Ifi214 UTSW 1 173,354,157 (GRCm39) missense probably benign 0.26
R4732:Ifi214 UTSW 1 173,354,157 (GRCm39) missense probably benign 0.26
R4733:Ifi214 UTSW 1 173,354,157 (GRCm39) missense probably benign 0.26
R5171:Ifi214 UTSW 1 173,354,200 (GRCm39) missense possibly damaging 0.93
R5531:Ifi214 UTSW 1 173,352,686 (GRCm39) missense probably damaging 1.00
R6290:Ifi214 UTSW 1 173,356,983 (GRCm39) missense probably damaging 1.00
R6499:Ifi214 UTSW 1 173,352,597 (GRCm39) missense probably damaging 0.99
R7271:Ifi214 UTSW 1 173,357,042 (GRCm39) missense probably damaging 0.96
R7290:Ifi214 UTSW 1 173,357,097 (GRCm39) missense probably benign 0.03
R7765:Ifi214 UTSW 1 173,352,402 (GRCm39) missense probably damaging 0.96
R8712:Ifi214 UTSW 1 173,355,486 (GRCm39) missense possibly damaging 0.83
R9144:Ifi214 UTSW 1 173,355,434 (GRCm39) missense possibly damaging 0.92
R9452:Ifi214 UTSW 1 173,356,894 (GRCm39) missense possibly damaging 0.79
R9534:Ifi214 UTSW 1 173,354,092 (GRCm39) missense probably benign 0.18
R9721:Ifi214 UTSW 1 173,355,479 (GRCm39) missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- GGGATTAGTGAGCTTGTCCAAG -3'
(R):5'- TGTTTGCCAGAATCTGACTCATC -3'

Sequencing Primer
(F):5'- TGTCCAAGGTTGCAATAGCC -3'
(R):5'- GGTGTCTGCAATAACAGCCTCAG -3'
Posted On 2021-04-30