Incidental Mutation 'R8807:Or5m8'
ID 672115
Institutional Source Beutler Lab
Gene Symbol Or5m8
Ensembl Gene ENSMUSG00000043267
Gene Name olfactory receptor family 5 subfamily M member 8
Synonyms GA_x6K02T2Q125-47470765-47471775, Olfr1031, MOR200-1
MMRRC Submission 068643-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.074) question?
Stock # R8807 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 85822163-85823173 bp(+) (GRCm39)
Type of Mutation makesense
DNA Base Change (assembly) A to T at 85823172 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Stop codon to Leucine at position 337 (*337L)
Ref Sequence ENSEMBL: ENSMUSP00000149225 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050942] [ENSMUST00000056849] [ENSMUST00000216807]
AlphaFold Q7TR87
Predicted Effect probably null
Transcript: ENSMUST00000050942
AA Change: *337L
SMART Domains Protein: ENSMUSP00000059256
Gene: ENSMUSG00000043267
AA Change: *337L

DomainStartEndE-ValueType
Pfam:7tm_4 30 307 1.1e-55 PFAM
Pfam:7tm_1 40 289 6.6e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000056849
SMART Domains Protein: ENSMUSP00000053309
Gene: ENSMUSG00000044923

DomainStartEndE-ValueType
Pfam:7tm_4 37 314 2.4e-58 PFAM
Pfam:7tm_1 47 296 3.2e-27 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000216807
AA Change: *337L
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 99% (74/75)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730480H06Rik T C 5: 48,534,494 (GRCm39) I118T probably damaging Het
Abca8a A T 11: 109,974,252 (GRCm39) F227L probably benign Het
Abcc6 A T 7: 45,648,431 (GRCm39) I687N possibly damaging Het
Akain1 T C 17: 69,794,340 (GRCm39) *70Q probably null Het
Allc C T 12: 28,615,489 (GRCm39) G89S probably damaging Het
Aoc1l3 T C 6: 48,965,188 (GRCm39) F399L probably benign Het
Artn A T 4: 117,783,915 (GRCm39) S184T possibly damaging Het
B3galt9 A T 2: 34,728,818 (GRCm39) I206F probably damaging Het
Bcl2a1c A T 9: 114,159,248 (GRCm39) I9F probably damaging Het
Cacna2d1 T A 5: 16,472,452 (GRCm39) D286E probably damaging Het
Cdc25a G A 9: 109,708,303 (GRCm39) E98K probably benign Het
Cdcp3 A T 7: 130,846,507 (GRCm39) I644F probably damaging Het
Cdr2l A T 11: 115,284,741 (GRCm39) Q359L probably damaging Het
Cmip C T 8: 118,138,094 (GRCm39) T103M probably benign Het
Dcaf1 A G 9: 106,742,268 (GRCm39) T1358A probably benign Het
Dedd2 C T 7: 24,910,705 (GRCm39) R157Q probably benign Het
Dhrs1 A G 14: 55,982,499 (GRCm39) V9A probably damaging Het
Dop1b T A 16: 93,558,973 (GRCm39) V573E probably benign Het
Eef2k A T 7: 120,490,930 (GRCm39) I517F possibly damaging Het
En1 T C 1: 120,531,090 (GRCm39) F110S possibly damaging Het
Evpl T A 11: 116,111,853 (GRCm39) I1946F probably damaging Het
Gaa A T 11: 119,168,393 (GRCm39) M502L probably benign Het
Gfer C T 17: 24,914,846 (GRCm39) A66T possibly damaging Het
Gm13271 A G 4: 88,673,213 (GRCm39) T37A probably benign Het
Grm3 C T 5: 9,561,499 (GRCm39) A784T probably damaging Het
H3c8 A G 13: 23,719,628 (GRCm39) K5E probably benign Het
Helz C G 11: 107,493,835 (GRCm39) S277C probably damaging Het
Henmt1 T G 3: 108,867,652 (GRCm39) *396G probably null Het
Hfe C T 13: 23,889,667 (GRCm39) V327I probably benign Het
Hoxd8 A T 2: 74,536,313 (GRCm39) Q141L probably damaging Het
Hspa12b T G 2: 130,987,103 (GRCm39) S675A probably benign Het
Ifi214 G A 1: 173,354,133 (GRCm39) T179I possibly damaging Het
Ighv5-9 T A 12: 113,625,404 (GRCm39) Y113F possibly damaging Het
Lca5l T A 16: 95,979,808 (GRCm39) R112S probably benign Het
Lmbrd1 C T 1: 24,770,843 (GRCm39) P257S probably benign Het
Loxhd1 C T 18: 77,444,468 (GRCm39) T608I possibly damaging Het
Lpl C A 8: 69,345,280 (GRCm39) L95I probably damaging Het
Lrp2bp A T 8: 46,473,732 (GRCm39) Q196L probably damaging Het
Ly6h A G 15: 75,438,056 (GRCm39) Y19H probably benign Het
Mfsd6 T C 1: 52,697,706 (GRCm39) probably benign Het
Mpo T C 11: 87,687,165 (GRCm39) I237T probably benign Het
Mrpl41 A G 2: 24,864,878 (GRCm39) W6R unknown Het
Muc16 T A 9: 18,567,353 (GRCm39) H1722L unknown Het
Mug1 A C 6: 121,851,434 (GRCm39) D777A probably benign Het
Myh1 A T 11: 67,111,354 (GRCm39) I1598F probably benign Het
Myo1f C T 17: 33,794,879 (GRCm39) R40C probably damaging Het
Myo6 G A 9: 80,207,949 (GRCm39) probably null Het
Nbeal2 G T 9: 110,458,707 (GRCm39) N2071K probably damaging Het
Nectin4 T A 1: 171,211,282 (GRCm39) C269S probably damaging Het
Nhlrc1 A T 13: 47,167,990 (GRCm39) L89Q probably damaging Het
Nup205 T C 6: 35,160,904 (GRCm39) F103S probably damaging Het
Obscn C A 11: 58,970,470 (GRCm39) V2379F probably damaging Het
Or5p62 A T 7: 107,771,852 (GRCm39) I33N possibly damaging Het
Plppr2 TCGCC TC 9: 21,855,727 (GRCm39) probably benign Het
Ptbp3 A G 4: 59,517,584 (GRCm39) V101A probably benign Het
Rps6kb2 C T 19: 4,213,229 (GRCm39) D6N probably damaging Het
Rsph1 T A 17: 31,484,828 (GRCm39) H154L probably damaging Het
Sdk1 G A 5: 142,071,382 (GRCm39) V1191M probably damaging Het
Selenos T A 7: 65,729,467 (GRCm39) D2E probably benign Het
Sema5a G A 15: 32,562,868 (GRCm39) G293D possibly damaging Het
Sgcg A G 14: 61,469,930 (GRCm39) S144P probably damaging Het
Sh3d19 T C 3: 85,992,659 (GRCm39) V229A probably benign Het
Sin3b C T 8: 73,476,708 (GRCm39) A714V probably benign Het
Slitrk6 T A 14: 110,988,123 (GRCm39) Q528L possibly damaging Het
Sprr2b CTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCC CTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCC 3: 92,224,826 (GRCm39) probably benign Het
Stard9 T A 2: 120,535,932 (GRCm39) L4063H probably damaging Het
Stard9 A C 2: 120,535,943 (GRCm39) K4067Q probably damaging Het
Terb1 A G 8: 105,195,741 (GRCm39) probably null Het
Tex2 T A 11: 106,435,194 (GRCm39) H744L unknown Het
Tex2 T C 11: 106,458,414 (GRCm39) S339G unknown Het
Tmem135 G C 7: 88,797,186 (GRCm39) L357V probably benign Het
Trhr A T 15: 44,061,212 (GRCm39) N244I probably benign Het
Ttn G A 2: 76,582,409 (GRCm39) A22828V probably damaging Het
Uchl1 C T 5: 66,833,601 (GRCm39) probably benign Het
Uroc1 A T 6: 90,328,110 (GRCm39) I529F probably damaging Het
Vps13c G T 9: 67,766,122 (GRCm39) V80F probably damaging Het
Wnt1 T A 15: 98,690,645 (GRCm39) C325S probably damaging Het
Other mutations in Or5m8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02104:Or5m8 APN 2 85,822,730 (GRCm39) missense probably damaging 1.00
IGL02475:Or5m8 APN 2 85,822,376 (GRCm39) missense probably benign 0.19
IGL03230:Or5m8 APN 2 85,822,583 (GRCm39) missense probably benign 0.00
IGL03405:Or5m8 APN 2 85,822,230 (GRCm39) missense possibly damaging 0.84
PIT4151001:Or5m8 UTSW 2 85,822,538 (GRCm39) missense probably damaging 0.96
PIT4366001:Or5m8 UTSW 2 85,822,385 (GRCm39) missense probably damaging 1.00
R0344:Or5m8 UTSW 2 85,822,726 (GRCm39) nonsense probably null
R1168:Or5m8 UTSW 2 85,823,028 (GRCm39) missense probably damaging 1.00
R1170:Or5m8 UTSW 2 85,823,040 (GRCm39) missense probably damaging 1.00
R2345:Or5m8 UTSW 2 85,822,166 (GRCm39) missense probably benign 0.01
R2915:Or5m8 UTSW 2 85,822,389 (GRCm39) missense probably damaging 1.00
R3498:Or5m8 UTSW 2 85,822,774 (GRCm39) missense probably benign 0.43
R4058:Or5m8 UTSW 2 85,822,576 (GRCm39) missense possibly damaging 0.87
R4747:Or5m8 UTSW 2 85,822,271 (GRCm39) missense probably damaging 1.00
R4859:Or5m8 UTSW 2 85,823,075 (GRCm39) missense probably damaging 0.96
R4991:Or5m8 UTSW 2 85,822,631 (GRCm39) missense probably damaging 0.99
R5438:Or5m8 UTSW 2 85,822,925 (GRCm39) missense probably damaging 1.00
R6362:Or5m8 UTSW 2 85,822,285 (GRCm39) missense probably damaging 1.00
R7458:Or5m8 UTSW 2 85,822,994 (GRCm39) missense probably damaging 1.00
R7535:Or5m8 UTSW 2 85,822,245 (GRCm39) missense probably benign 0.37
R9130:Or5m8 UTSW 2 85,822,819 (GRCm39) nonsense probably null
R9366:Or5m8 UTSW 2 85,822,731 (GRCm39) missense possibly damaging 0.88
R9687:Or5m8 UTSW 2 85,822,220 (GRCm39) missense probably benign
R9746:Or5m8 UTSW 2 85,823,091 (GRCm39) missense probably benign 0.18
R9794:Or5m8 UTSW 2 85,822,464 (GRCm39) missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- ATTCCCATGTTGAACCCCATG -3'
(R):5'- TATCTTCCAGCAGTAGTCACAG -3'

Sequencing Primer
(F):5'- CCCATGATTTACAGCCTGAGG -3'
(R):5'- TTCCAGCAGTAGTCACAGATGTAAAG -3'
Posted On 2021-04-30