Incidental Mutation 'R8807:Abcc6'
ID 672135
Institutional Source Beutler Lab
Gene Symbol Abcc6
Ensembl Gene ENSMUSG00000030834
Gene Name ATP-binding cassette, sub-family C (CFTR/MRP), member 6
Synonyms Mrp6, DCC, Dyscalc1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.692) question?
Stock # R8807 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 45967555-46030302 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 45999007 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 687 (I687N)
Ref Sequence ENSEMBL: ENSMUSP00000002850 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002850]
AlphaFold Q9R1S7
Predicted Effect possibly damaging
Transcript: ENSMUST00000002850
AA Change: I687N

PolyPhen 2 Score 0.665 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000002850
Gene: ENSMUSG00000030834
AA Change: I687N

DomainStartEndE-ValueType
transmembrane domain 44 61 N/A INTRINSIC
transmembrane domain 81 100 N/A INTRINSIC
transmembrane domain 110 129 N/A INTRINSIC
transmembrane domain 142 161 N/A INTRINSIC
transmembrane domain 171 193 N/A INTRINSIC
Pfam:ABC_membrane 309 580 3.5e-29 PFAM
AAA 653 828 1.19e-9 SMART
low complexity region 871 885 N/A INTRINSIC
Pfam:ABC_membrane 942 1211 2.5e-32 PFAM
AAA 1286 1473 1.71e-10 SMART
Meta Mutation Damage Score 0.3280 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 99% (74/75)
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MRP subfamily which is involved in multi-drug resistance. The specific function of this protein is unknown; however, a similar rat protein has been identified as the major canalicular bile salt export pump of liver. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display patchy mineralization which may include the capsule surrounding the sinuses of vibrissae, medium sized arteries, skin, retina, kidney, and interscapular brown fat. Strain differences at this locus may lead to altered susceptibility to cardiac calcinosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik A T 7: 131,244,778 I644F probably damaging Het
5730480H06Rik T C 5: 48,377,152 I118T probably damaging Het
Abca8a A T 11: 110,083,426 F227L probably benign Het
Akain1 T C 17: 69,487,345 *70Q probably null Het
Allc C T 12: 28,565,490 G89S probably damaging Het
Artn A T 4: 117,926,718 S184T possibly damaging Het
Bcl2a1c A T 9: 114,330,180 I9F probably damaging Het
Cacna2d1 T A 5: 16,267,454 D286E probably damaging Het
Cdc25a G A 9: 109,879,235 E98K probably benign Het
Cdr2l A T 11: 115,393,915 Q359L probably damaging Het
Cmip C T 8: 117,411,355 T103M probably benign Het
Dcaf1 A G 9: 106,865,069 T1358A probably benign Het
Dedd2 C T 7: 25,211,280 R157Q probably benign Het
Dhrs1 A G 14: 55,745,042 V9A probably damaging Het
Dopey2 T A 16: 93,762,085 V573E probably benign Het
Eef2k A T 7: 120,891,707 I517F possibly damaging Het
En1 T C 1: 120,603,361 F110S possibly damaging Het
Evpl T A 11: 116,221,027 I1946F probably damaging Het
Gaa A T 11: 119,277,567 M502L probably benign Het
Gfer C T 17: 24,695,872 A66T possibly damaging Het
Gm13271 A G 4: 88,754,976 T37A probably benign Het
Gm34653 A T 2: 34,838,806 I206F probably damaging Het
Grm3 C T 5: 9,511,499 A784T probably damaging Het
Helz C G 11: 107,603,009 S277C probably damaging Het
Henmt1 T G 3: 108,960,336 *396G probably null Het
Hfe C T 13: 23,705,684 V327I probably benign Het
Hist1h3g A G 13: 23,535,458 K5E probably benign Het
Hoxd8 A T 2: 74,705,969 Q141L probably damaging Het
Hspa12b T G 2: 131,145,183 S675A probably benign Het
Ifi214 G A 1: 173,526,567 T179I possibly damaging Het
Ighv5-9 T A 12: 113,661,784 Y113F possibly damaging Het
Lca5l T A 16: 96,178,608 R112S probably benign Het
Lmbrd1 C T 1: 24,731,762 P257S probably benign Het
Loxhd1 C T 18: 77,356,772 T608I possibly damaging Het
Lpl C A 8: 68,892,628 L95I probably damaging Het
Lrp2bp A T 8: 46,020,695 Q196L probably damaging Het
Ly6h A G 15: 75,566,207 Y19H probably benign Het
Mfsd6 T C 1: 52,658,547 probably benign Het
Mpo T C 11: 87,796,339 I237T probably benign Het
Mrpl41 A G 2: 24,974,866 W6R unknown Het
Muc16 T A 9: 18,656,057 H1722L unknown Het
Mug1 A C 6: 121,874,475 D777A probably benign Het
Myh1 A T 11: 67,220,528 I1598F probably benign Het
Myo1f C T 17: 33,575,905 R40C probably damaging Het
Myo6 G A 9: 80,300,667 probably null Het
Nbeal2 G T 9: 110,629,639 N2071K probably damaging Het
Nectin4 T A 1: 171,383,714 C269S probably damaging Het
Nhlrc1 A T 13: 47,014,514 L89Q probably damaging Het
Nup205 T C 6: 35,183,969 F103S probably damaging Het
Obscn C A 11: 59,079,644 V2379F probably damaging Het
Olfr1031 A T 2: 85,992,828 *337L probably null Het
Olfr486 A T 7: 108,172,645 I33N possibly damaging Het
Plppr2 TCGCC TC 9: 21,944,431 probably benign Het
Ptbp3 A G 4: 59,517,584 V101A probably benign Het
Rps6kb2 C T 19: 4,163,230 D6N probably damaging Het
Rsph1 T A 17: 31,265,854 H154L probably damaging Het
Sdk1 G A 5: 142,085,627 V1191M probably damaging Het
Selenos T A 7: 66,079,719 D2E probably benign Het
Sema5a G A 15: 32,562,722 G293D possibly damaging Het
Sgcg A G 14: 61,232,481 S144P probably damaging Het
Sh3d19 T C 3: 86,085,352 V229A probably benign Het
Sin3b C T 8: 72,750,080 A714V probably benign Het
Slitrk6 T A 14: 110,750,691 Q528L possibly damaging Het
Sprr2b CTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCC CTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCC 3: 92,317,519 probably benign Het
Stard9 T A 2: 120,705,451 L4063H probably damaging Het
Stard9 A C 2: 120,705,462 K4067Q probably damaging Het
Svs1 T C 6: 48,988,254 F399L probably benign Het
Terb1 A G 8: 104,469,109 probably null Het
Tex2 T A 11: 106,544,368 H744L unknown Het
Tex2 T C 11: 106,567,588 S339G unknown Het
Tmem135 G C 7: 89,147,978 L357V probably benign Het
Trhr A T 15: 44,197,816 N244I probably benign Het
Ttn G A 2: 76,752,065 A22828V probably damaging Het
Uchl1 C T 5: 66,676,258 probably benign Het
Uroc1 A T 6: 90,351,128 I529F probably damaging Het
Vps13c G T 9: 67,858,840 V80F probably damaging Het
Wnt1 T A 15: 98,792,764 C325S probably damaging Het
Other mutations in Abcc6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01589:Abcc6 APN 7 46002672 splice site probably benign
IGL01731:Abcc6 APN 7 46002610 missense possibly damaging 0.71
IGL01743:Abcc6 APN 7 45996814 missense probably benign 0.02
IGL01757:Abcc6 APN 7 45990281 splice site probably benign
IGL01895:Abcc6 APN 7 46029058 missense possibly damaging 0.88
IGL01942:Abcc6 APN 7 45986573 missense possibly damaging 0.89
IGL02251:Abcc6 APN 7 45977416 missense probably damaging 1.00
IGL02277:Abcc6 APN 7 46001061 missense probably benign 0.00
IGL02548:Abcc6 APN 7 46005262 missense probably damaging 0.98
IGL03063:Abcc6 APN 7 46016432 missense probably benign
IGL03092:Abcc6 APN 7 45986470 missense probably damaging 1.00
IGL03251:Abcc6 APN 7 45982237 unclassified probably benign
R0057:Abcc6 UTSW 7 46020143 missense probably benign 0.03
R0944:Abcc6 UTSW 7 46015505 missense possibly damaging 0.81
R1019:Abcc6 UTSW 7 46014107 missense possibly damaging 0.77
R1183:Abcc6 UTSW 7 45985253 missense probably damaging 0.99
R1543:Abcc6 UTSW 7 46016504 missense probably benign 0.01
R1550:Abcc6 UTSW 7 46005244 missense probably benign 0.25
R1725:Abcc6 UTSW 7 45992357 missense possibly damaging 0.76
R1907:Abcc6 UTSW 7 46014169 missense probably benign 0.04
R1908:Abcc6 UTSW 7 46020134 splice site probably null
R1909:Abcc6 UTSW 7 46020134 splice site probably null
R2138:Abcc6 UTSW 7 45981051 missense probably damaging 1.00
R2145:Abcc6 UTSW 7 45998741 missense probably benign 0.01
R2402:Abcc6 UTSW 7 46015575 missense probably benign 0.04
R3983:Abcc6 UTSW 7 45995289 missense probably benign
R4013:Abcc6 UTSW 7 46018680 missense probably benign 0.01
R4051:Abcc6 UTSW 7 45986563 missense probably damaging 1.00
R4052:Abcc6 UTSW 7 45986563 missense probably damaging 1.00
R4208:Abcc6 UTSW 7 45986563 missense probably damaging 1.00
R4362:Abcc6 UTSW 7 45998832 splice site probably benign
R4385:Abcc6 UTSW 7 45995328 missense possibly damaging 0.93
R4399:Abcc6 UTSW 7 46002607 missense probably benign
R4479:Abcc6 UTSW 7 46005239 missense possibly damaging 0.60
R4480:Abcc6 UTSW 7 46005239 missense possibly damaging 0.60
R4780:Abcc6 UTSW 7 45996691 missense probably benign
R4791:Abcc6 UTSW 7 45982160 missense probably benign 0.00
R4895:Abcc6 UTSW 7 45980990 missense possibly damaging 0.95
R4898:Abcc6 UTSW 7 45989687 missense probably damaging 0.96
R4905:Abcc6 UTSW 7 45995225 missense probably benign
R4941:Abcc6 UTSW 7 46012523 missense probably benign 0.00
R5040:Abcc6 UTSW 7 46020154 missense probably benign 0.04
R5128:Abcc6 UTSW 7 45989646 missense probably benign 0.00
R5284:Abcc6 UTSW 7 45981059 missense probably benign 0.05
R5328:Abcc6 UTSW 7 45992311 missense probably benign 0.01
R5459:Abcc6 UTSW 7 45982183 missense probably benign 0.00
R5543:Abcc6 UTSW 7 45989536 critical splice donor site probably null
R6178:Abcc6 UTSW 7 46029044 missense probably benign
R6228:Abcc6 UTSW 7 46030256 missense probably benign 0.02
R6532:Abcc6 UTSW 7 45977379 missense probably damaging 1.00
R6605:Abcc6 UTSW 7 45981057 missense probably damaging 1.00
R7000:Abcc6 UTSW 7 46005522 missense possibly damaging 0.60
R7067:Abcc6 UTSW 7 46018690 missense probably benign
R7553:Abcc6 UTSW 7 45999121 missense probably damaging 1.00
R7597:Abcc6 UTSW 7 45995237 missense probably damaging 1.00
R7718:Abcc6 UTSW 7 45977392 missense possibly damaging 0.91
R7781:Abcc6 UTSW 7 46005606 missense probably damaging 1.00
R7798:Abcc6 UTSW 7 45976853 nonsense probably null
R7896:Abcc6 UTSW 7 45977379 missense probably damaging 1.00
R8098:Abcc6 UTSW 7 45996665 missense probably damaging 1.00
R8443:Abcc6 UTSW 7 45980025 missense probably damaging 1.00
R8773:Abcc6 UTSW 7 45985145 missense probably benign
R8784:Abcc6 UTSW 7 46002601 missense probably benign
R8802:Abcc6 UTSW 7 46008859 missense probably damaging 0.99
R9006:Abcc6 UTSW 7 46016396 missense probably benign 0.00
R9127:Abcc6 UTSW 7 45979760 missense probably damaging 1.00
X0065:Abcc6 UTSW 7 46020197 missense probably damaging 0.99
Z1176:Abcc6 UTSW 7 45979734 missense probably damaging 1.00
Z1176:Abcc6 UTSW 7 45992306 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AACCCTGAAACACTTCTTACTGTTG -3'
(R):5'- AAGGTCTGAGTAGCCGGATG -3'

Sequencing Primer
(F):5'- GAAACACTTCTTACTGTTGGTAGTTC -3'
(R):5'- GGAATTGCCTGCTTCTGTACACAC -3'
Posted On 2021-04-30