Incidental Mutation 'R8807:Olfr486'
ID 672138
Institutional Source Beutler Lab
Gene Symbol Olfr486
Ensembl Gene ENSMUSG00000096068
Gene Name olfactory receptor 486
Synonyms MOR204-19, GA_x6K02T2PBJ9-10501920-10500976
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock # R8807 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 108171798-108172742 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 108172645 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 33 (I33N)
Ref Sequence ENSEMBL: ENSMUSP00000071918 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072035]
AlphaFold Q8VFD0
Predicted Effect possibly damaging
Transcript: ENSMUST00000072035
AA Change: I33N

PolyPhen 2 Score 0.929 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000071918
Gene: ENSMUSG00000096068
AA Change: I33N

DomainStartEndE-ValueType
Pfam:7tm_4 31 311 6.8e-51 PFAM
Pfam:7tm_1 44 293 6.6e-24 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 99% (74/75)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik A T 7: 131,244,778 I644F probably damaging Het
5730480H06Rik T C 5: 48,377,152 I118T probably damaging Het
Abca8a A T 11: 110,083,426 F227L probably benign Het
Abcc6 A T 7: 45,999,007 I687N possibly damaging Het
Akain1 T C 17: 69,487,345 *70Q probably null Het
Allc C T 12: 28,565,490 G89S probably damaging Het
Artn A T 4: 117,926,718 S184T possibly damaging Het
Bcl2a1c A T 9: 114,330,180 I9F probably damaging Het
Cacna2d1 T A 5: 16,267,454 D286E probably damaging Het
Cdc25a G A 9: 109,879,235 E98K probably benign Het
Cdr2l A T 11: 115,393,915 Q359L probably damaging Het
Cmip C T 8: 117,411,355 T103M probably benign Het
Dcaf1 A G 9: 106,865,069 T1358A probably benign Het
Dedd2 C T 7: 25,211,280 R157Q probably benign Het
Dhrs1 A G 14: 55,745,042 V9A probably damaging Het
Dopey2 T A 16: 93,762,085 V573E probably benign Het
Eef2k A T 7: 120,891,707 I517F possibly damaging Het
En1 T C 1: 120,603,361 F110S possibly damaging Het
Evpl T A 11: 116,221,027 I1946F probably damaging Het
Gaa A T 11: 119,277,567 M502L probably benign Het
Gfer C T 17: 24,695,872 A66T possibly damaging Het
Gm13271 A G 4: 88,754,976 T37A probably benign Het
Gm34653 A T 2: 34,838,806 I206F probably damaging Het
Grm3 C T 5: 9,511,499 A784T probably damaging Het
Helz C G 11: 107,603,009 S277C probably damaging Het
Henmt1 T G 3: 108,960,336 *396G probably null Het
Hfe C T 13: 23,705,684 V327I probably benign Het
Hist1h3g A G 13: 23,535,458 K5E probably benign Het
Hoxd8 A T 2: 74,705,969 Q141L probably damaging Het
Hspa12b T G 2: 131,145,183 S675A probably benign Het
Ifi214 G A 1: 173,526,567 T179I possibly damaging Het
Ighv5-9 T A 12: 113,661,784 Y113F possibly damaging Het
Lca5l T A 16: 96,178,608 R112S probably benign Het
Lmbrd1 C T 1: 24,731,762 P257S probably benign Het
Loxhd1 C T 18: 77,356,772 T608I possibly damaging Het
Lpl C A 8: 68,892,628 L95I probably damaging Het
Lrp2bp A T 8: 46,020,695 Q196L probably damaging Het
Ly6h A G 15: 75,566,207 Y19H probably benign Het
Mfsd6 T C 1: 52,658,547 probably benign Het
Mpo T C 11: 87,796,339 I237T probably benign Het
Mrpl41 A G 2: 24,974,866 W6R unknown Het
Muc16 T A 9: 18,656,057 H1722L unknown Het
Mug1 A C 6: 121,874,475 D777A probably benign Het
Myh1 A T 11: 67,220,528 I1598F probably benign Het
Myo1f C T 17: 33,575,905 R40C probably damaging Het
Myo6 G A 9: 80,300,667 probably null Het
Nbeal2 G T 9: 110,629,639 N2071K probably damaging Het
Nectin4 T A 1: 171,383,714 C269S probably damaging Het
Nhlrc1 A T 13: 47,014,514 L89Q probably damaging Het
Nup205 T C 6: 35,183,969 F103S probably damaging Het
Obscn C A 11: 59,079,644 V2379F probably damaging Het
Olfr1031 A T 2: 85,992,828 *337L probably null Het
Plppr2 TCGCC TC 9: 21,944,431 probably benign Het
Ptbp3 A G 4: 59,517,584 V101A probably benign Het
Rps6kb2 C T 19: 4,163,230 D6N probably damaging Het
Rsph1 T A 17: 31,265,854 H154L probably damaging Het
Sdk1 G A 5: 142,085,627 V1191M probably damaging Het
Selenos T A 7: 66,079,719 D2E probably benign Het
Sema5a G A 15: 32,562,722 G293D possibly damaging Het
Sgcg A G 14: 61,232,481 S144P probably damaging Het
Sh3d19 T C 3: 86,085,352 V229A probably benign Het
Sin3b C T 8: 72,750,080 A714V probably benign Het
Slitrk6 T A 14: 110,750,691 Q528L possibly damaging Het
Sprr2b CTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCC CTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCC 3: 92,317,519 probably benign Het
Stard9 T A 2: 120,705,451 L4063H probably damaging Het
Stard9 A C 2: 120,705,462 K4067Q probably damaging Het
Svs1 T C 6: 48,988,254 F399L probably benign Het
Terb1 A G 8: 104,469,109 probably null Het
Tex2 T A 11: 106,544,368 H744L unknown Het
Tex2 T C 11: 106,567,588 S339G unknown Het
Tmem135 G C 7: 89,147,978 L357V probably benign Het
Trhr A T 15: 44,197,816 N244I probably benign Het
Ttn G A 2: 76,752,065 A22828V probably damaging Het
Uchl1 C T 5: 66,676,258 probably benign Het
Uroc1 A T 6: 90,351,128 I529F probably damaging Het
Vps13c G T 9: 67,858,840 V80F probably damaging Het
Wnt1 T A 15: 98,792,764 C325S probably damaging Het
Other mutations in Olfr486
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0033:Olfr486 UTSW 7 108171927 missense probably benign 0.09
R0144:Olfr486 UTSW 7 108171971 missense probably benign 0.00
R0165:Olfr486 UTSW 7 108172675 missense probably benign 0.03
R0739:Olfr486 UTSW 7 108172010 missense probably benign 0.00
R1027:Olfr486 UTSW 7 108172141 missense probably damaging 0.98
R1781:Olfr486 UTSW 7 108171883 missense probably benign 0.06
R3729:Olfr486 UTSW 7 108172309 missense probably benign 0.13
R4505:Olfr486 UTSW 7 108171968 missense probably benign 0.00
R5223:Olfr486 UTSW 7 108172708 missense probably benign 0.20
R7089:Olfr486 UTSW 7 108172494 missense probably benign 0.01
R7499:Olfr486 UTSW 7 108171800 makesense probably null
R7894:Olfr486 UTSW 7 108172184 missense probably benign
R7995:Olfr486 UTSW 7 108172000 missense probably damaging 1.00
R9050:Olfr486 UTSW 7 108171880 missense probably damaging 1.00
R9244:Olfr486 UTSW 7 108172645 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- CCACATCCAAGGTAGGAGATGG -3'
(R):5'- TATGTGTCTGAAGAGAGTGATGCAG -3'

Sequencing Primer
(F):5'- GTTTTTCTCAGTCAGGAAGTTGAC -3'
(R):5'- GTGAGTTCCAAGAATCAAACTCTGG -3'
Posted On 2021-04-30