Incidental Mutation 'K3955:Uggt1'
ID67215
Institutional Source Beutler Lab
Gene Symbol Uggt1
Ensembl Gene ENSMUSG00000037470
Gene NameUDP-glucose glycoprotein glucosyltransferase 1
SynonymsUgcgl1, C820010P03Rik, A930007H10Rik, 0910001L17Rik
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.614) question?
Stock #K3955 (G3) of strain 706
Quality Score225
Status Validated
Chromosome1
Chromosomal Location36140027-36244720 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 36162353 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 1102 (I1102T)
Ref Sequence ENSEMBL: ENSMUSP00000037930 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046875] [ENSMUST00000173166] [ENSMUST00000174266]
Predicted Effect probably benign
Transcript: ENSMUST00000046875
AA Change: I1102T

PolyPhen 2 Score 0.367 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000037930
Gene: ENSMUSG00000037470
AA Change: I1102T

DomainStartEndE-ValueType
signal peptide 1 42 N/A INTRINSIC
Pfam:UDP-g_GGTase 44 1222 N/A PFAM
SCOP:d1ga8a_ 1256 1521 3e-45 SMART
Blast:BROMO 1414 1453 3e-17 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173082
Predicted Effect probably benign
Transcript: ENSMUST00000173166
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173999
Predicted Effect probably benign
Transcript: ENSMUST00000174224
Predicted Effect probably benign
Transcript: ENSMUST00000174266
SMART Domains Protein: ENSMUSP00000134640
Gene: ENSMUSG00000037470

DomainStartEndE-ValueType
signal peptide 1 42 N/A INTRINSIC
low complexity region 88 97 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.9%
  • 10x: 97.4%
  • 20x: 94.9%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] UDP-glucose:glycoprotein glucosyltransferase (UGT) is a soluble protein of the endoplasmic reticulum (ER) that selectively reglucosylates unfolded glycoproteins, thus providing quality control for protein transport out of the ER.[supplied by OMIM, Oct 2009]
PHENOTYPE: Heterozygous KO reduces susceptibility to and morbidity of RNA virus infection. Homozygous KO is embryonic lethal. The peptide is a folding sensor for glycoproteins in the ER. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agap1 G A 1: 89,887,604 R738H probably damaging Het
Arhgap28 T C 17: 68,004,006 E2G probably damaging Het
Atad2b C A 12: 4,954,536 probably benign Het
Atmin T A 8: 116,957,036 C478* probably null Het
Calr T C 8: 84,846,273 Y57C probably damaging Het
Cdh13 G A 8: 118,675,104 V82M probably damaging Het
Ces3a A T 8: 105,050,627 probably benign Het
Dmbt1 T C 7: 131,119,564 Y1854H probably damaging Het
Dnah1 T A 14: 31,266,459 M3429L probably benign Het
Dscam A G 16: 96,673,687 F1225S probably benign Het
E030025P04Rik G A 11: 109,143,952 P37S unknown Het
Eral1 A T 11: 78,076,021 D189E probably damaging Het
Fbxw14 G T 9: 109,276,245 P284Q possibly damaging Het
Fcrl6 A G 1: 172,597,684 V260A probably benign Het
Fezf2 A T 14: 12,345,097 F30Y probably damaging Het
Gjb4 A T 4: 127,351,500 V216D probably benign Het
Gm13023 T C 4: 143,795,140 I442T possibly damaging Het
Gm9758 G A 5: 14,913,508 probably benign Het
Gm9758 C G 5: 14,913,539 V92L probably benign Het
Gmps A C 3: 64,001,533 R485S probably damaging Het
Gtdc1 C T 2: 44,752,221 probably null Het
H2-Ob C T 17: 34,241,184 R19C probably damaging Het
Lars2 T C 9: 123,377,777 V103A probably damaging Het
Ndnf G A 6: 65,701,429 probably benign Het
Nectin1 A G 9: 43,792,078 Y211C probably damaging Het
Notch4 C T 17: 34,568,462 T332I probably damaging Het
Olfr272 A G 4: 52,911,081 F238L probably damaging Het
Olfr945 A C 9: 39,258,630 L14W probably damaging Het
Olfr968 A G 9: 39,772,173 I209T probably benign Het
Paf1 T C 7: 28,396,925 probably null Het
Pcdhb1 G T 18: 37,265,973 G326C probably damaging Het
Plcl1 A G 1: 55,697,939 Y813C possibly damaging Het
Prkcq T C 2: 11,246,793 probably benign Het
Proser3 G T 7: 30,543,499 P218T probably damaging Het
Rccd1 G A 7: 80,320,671 S66F probably benign Het
Recql G T 6: 142,378,206 S54* probably null Het
Samd15 G T 12: 87,200,760 G73V probably benign Het
Siglec1 T C 2: 131,081,439 N462S probably benign Het
Skiv2l2 A C 13: 112,910,979 Y277* probably null Het
Syne2 G T 12: 75,930,665 A1296S probably damaging Het
Tlk1 T C 2: 70,721,701 E542G possibly damaging Het
Tnks1bp1 C T 2: 85,062,411 T232I probably benign Het
Tnrc6c T A 11: 117,760,738 Y1696N probably damaging Het
Vmn1r84 C T 7: 12,361,957 V270M probably damaging Het
Wasf1 C T 10: 40,936,195 P327S unknown Het
Other mutations in Uggt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Uggt1 APN 1 36179552 splice site probably benign
IGL00817:Uggt1 APN 1 36185932 missense probably benign 0.03
IGL01395:Uggt1 APN 1 36155077 missense probably damaging 1.00
IGL01609:Uggt1 APN 1 36182474 missense probably damaging 1.00
IGL01619:Uggt1 APN 1 36161694 missense probably damaging 0.99
IGL02077:Uggt1 APN 1 36176794 missense probably damaging 0.99
IGL02313:Uggt1 APN 1 36184484 missense probably damaging 0.99
IGL02341:Uggt1 APN 1 36164519 makesense probably null
IGL02346:Uggt1 APN 1 36179670 missense probably benign 0.00
IGL02447:Uggt1 APN 1 36150142 missense probably damaging 1.00
IGL02883:Uggt1 APN 1 36177615 missense probably benign 0.03
IGL02930:Uggt1 APN 1 36157456 missense probably benign 0.01
IGL03153:Uggt1 APN 1 36202818 missense possibly damaging 0.94
IGL03162:Uggt1 APN 1 36207956 missense probably damaging 1.00
IGL03170:Uggt1 APN 1 36163261 missense probably damaging 1.00
IGL03266:Uggt1 APN 1 36150048 missense probably damaging 1.00
R0037:Uggt1 UTSW 1 36185932 missense probably benign 0.03
R0037:Uggt1 UTSW 1 36185932 missense probably benign 0.03
R0167:Uggt1 UTSW 1 36170197 critical splice donor site probably null
R0373:Uggt1 UTSW 1 36179670 missense probably benign 0.00
R0502:Uggt1 UTSW 1 36159946 missense probably damaging 1.00
R0546:Uggt1 UTSW 1 36195971 missense probably benign 0.00
R0610:Uggt1 UTSW 1 36165506 splice site probably benign
R0671:Uggt1 UTSW 1 36155128 missense probably damaging 1.00
R0760:Uggt1 UTSW 1 36161724 missense possibly damaging 0.68
R0825:Uggt1 UTSW 1 36158143 missense probably benign 0.01
R0827:Uggt1 UTSW 1 36156313 critical splice acceptor site probably null
R0884:Uggt1 UTSW 1 36175078 missense probably benign 0.00
R1112:Uggt1 UTSW 1 36173546 missense possibly damaging 0.54
R1470:Uggt1 UTSW 1 36176796 missense probably benign 0.13
R1470:Uggt1 UTSW 1 36176796 missense probably benign 0.13
R1592:Uggt1 UTSW 1 36202858 missense probably benign 0.04
R1730:Uggt1 UTSW 1 36221261 missense probably benign 0.05
R1923:Uggt1 UTSW 1 36179613 missense probably damaging 0.99
R1970:Uggt1 UTSW 1 36151781 missense probably damaging 1.00
R2086:Uggt1 UTSW 1 36192414 missense probably null 1.00
R2829:Uggt1 UTSW 1 36162294 missense probably benign 0.38
R3431:Uggt1 UTSW 1 36210059 nonsense probably null
R3432:Uggt1 UTSW 1 36210059 nonsense probably null
R3725:Uggt1 UTSW 1 36182507 nonsense probably null
R3880:Uggt1 UTSW 1 36176804 intron probably benign
R4052:Uggt1 UTSW 1 36164489 missense probably damaging 0.98
R4133:Uggt1 UTSW 1 36158159 missense probably damaging 1.00
R4489:Uggt1 UTSW 1 36146668 nonsense probably null
R4570:Uggt1 UTSW 1 36150073 missense probably damaging 1.00
R4866:Uggt1 UTSW 1 36202855 nonsense probably null
R4895:Uggt1 UTSW 1 36156264 missense probably damaging 1.00
R4900:Uggt1 UTSW 1 36202855 nonsense probably null
R5372:Uggt1 UTSW 1 36244060 splice site probably benign
R5385:Uggt1 UTSW 1 36184412 missense probably damaging 1.00
R5652:Uggt1 UTSW 1 36216153 nonsense probably null
R5694:Uggt1 UTSW 1 36179656 missense probably damaging 1.00
R5732:Uggt1 UTSW 1 36161771 splice site probably null
R5893:Uggt1 UTSW 1 36227628 splice site probably null
R6191:Uggt1 UTSW 1 36162208 missense probably damaging 0.98
R6247:Uggt1 UTSW 1 36163228 missense probably damaging 1.00
R6259:Uggt1 UTSW 1 36234916 missense probably benign 0.00
R6399:Uggt1 UTSW 1 36163366 missense possibly damaging 0.90
R6439:Uggt1 UTSW 1 36174951 missense possibly damaging 0.95
R6468:Uggt1 UTSW 1 36173450 missense probably benign 0.00
R6788:Uggt1 UTSW 1 36230688 missense probably benign 0.00
R7165:Uggt1 UTSW 1 36155107 missense probably benign 0.41
R7255:Uggt1 UTSW 1 36146106 missense probably damaging 1.00
R7273:Uggt1 UTSW 1 36162221 missense probably damaging 0.99
R7469:Uggt1 UTSW 1 36151733 missense probably damaging 1.00
R7490:Uggt1 UTSW 1 36164508 missense probably benign 0.01
R7570:Uggt1 UTSW 1 36185838 missense probably benign 0.09
R7612:Uggt1 UTSW 1 36163235 missense probably damaging 0.99
R7759:Uggt1 UTSW 1 36146725 missense possibly damaging 0.81
R7792:Uggt1 UTSW 1 36207984 missense probably damaging 1.00
R7816:Uggt1 UTSW 1 36163315 missense possibly damaging 0.95
R7858:Uggt1 UTSW 1 36156258 missense probably damaging 1.00
R7887:Uggt1 UTSW 1 36208034 missense probably damaging 0.99
R7941:Uggt1 UTSW 1 36156258 missense probably damaging 1.00
R7970:Uggt1 UTSW 1 36208034 missense probably damaging 0.99
R8040:Uggt1 UTSW 1 36211473 missense possibly damaging 0.70
R8093:Uggt1 UTSW 1 36227485 missense probably damaging 1.00
X0022:Uggt1 UTSW 1 36165555 missense possibly damaging 0.67
Z1088:Uggt1 UTSW 1 36174191 missense probably damaging 1.00
Z1176:Uggt1 UTSW 1 36161695 missense probably damaging 1.00
Z1177:Uggt1 UTSW 1 36155073 missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- TCACACCAAGGTTCAGAATGCTAACTG -3'
(R):5'- TCCTAAGAATGCAGCCTGTGGTGC -3'

Sequencing Primer
(F):5'- CCATCACGGAAGTTGTACTATCG -3'
(R):5'- ccaggaagcaaagagaggag -3'
Posted On2013-09-03