Mutagenetix > Incidental Mutation

Incidental Mutation 'R8808:Itga8'

672188

Institutional Source

Beutler Lab

Gene Symbol

Itga8

Ensembl Gene

ENSMUSG00000026768

Gene Name

integrin alpha 8

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Probably essential (E-score: 0.892) question?

Stock #

R8808 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

12106632-12301922 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

A to T at 12132517 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Stop codon at position 933 (C933*)

Ref Sequence

ENSEMBL: ENSMUSP00000028106 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028106] [ENSMUST00000148055] [ENSMUST00000172791]

AlphaFold

A2ARA8

Predicted Effect

probably null
Transcript: ENSMUST00000028106
AA Change: C933*

SMART Domains

Protein: ENSMUSP00000028106
Gene: ENSMUSG00000026768
AA Change: C933*

Domain	Start	End	E-Value	Type
signal peptide	1	37	N/A	INTRINSIC
Int_alpha	52	112	8.48e-8	SMART
Int_alpha	197	244	4.8e1	SMART
Int_alpha	262	312	5.91e-7	SMART
Int_alpha	316	377	6.94e-13	SMART
Int_alpha	381	437	1.92e-15	SMART
Int_alpha	445	494	8.23e-6	SMART
SCOP:d1m1xa2	643	780	2e-46	SMART
SCOP:d1m1xa3	784	1000	2e-80	SMART
transmembrane domain	1011	1033	N/A	INTRINSIC
Pfam:Integrin_alpha	1034	1048	2.5e-7	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000148055
AA Change: C12*

SMART Domains

Protein: ENSMUSP00000134238
Gene: ENSMUSG00000026768
AA Change: C12*

Domain	Start	End	E-Value	Type
SCOP:d1m1xa3	1	79	7e-32	SMART
PDB:3IJE\|A	2	89	9e-15	PDB
transmembrane domain	90	112	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000172791

SMART Domains

Protein: ENSMUSP00000134154
Gene: ENSMUSG00000026768

Domain	Start	End	E-Value	Type
signal peptide	1	37	N/A	INTRINSIC
Int_alpha	52	112	8.48e-8	SMART
Int_alpha	197	244	4.8e1	SMART
Int_alpha	262	312	5.91e-7	SMART
Int_alpha	316	377	6.94e-13	SMART
Int_alpha	381	437	1.92e-15	SMART
Int_alpha	445	494	8.23e-6	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

95% (60/63)

MGI Phenotype

FUNCTION: This gene encodes a member of the integrin family of cell surface proteins that mediate cellular interactions with the extracellular matrix and other cells. The encoded protein undergoes proteolytic processing to generate the disulfide-linked heterodimeric alpha subunit which, in turn associates with a beta subunit to form the functional integrin receptor. Mice lacking the encoded protein mostly die after birth due to kidney defects, but some of animals that survive exhibit defects in the sensory hair cells of the inner ear. [provided by RefSeq, Aug 2016]
PHENOTYPE: Mice homozygous for disruptions in this gene usually die by the end of the second day after birth. Those that do survive have reduced kidneys and abnormal steriocilia in the inner ear. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110002E22Rik	C	T	3: 138,070,113	P1688S	probably benign	Het
4933412E24Rik	T	C	15: 60,016,070	T174A	probably benign	Het
Actl10	T	A	2: 154,553,148	L340Q	probably damaging	Het
Adra1d	T	C	2: 131,561,477	E231G	probably damaging	Het
Agt	T	A	8: 124,564,289	D93V	probably benign	Het
Als2cl	G	T	9: 110,889,214	R341L	possibly damaging	Het
Ankrd63	G	T	2: 118,703,068	A124E	unknown	Het
Aqp8	T	C	7: 123,466,699	L239P	probably damaging	Het
Arhgef11	A	G	3: 87,686,029	E85G	probably damaging	Het
Cacng4	T	A	11: 107,794,383	I28F	possibly damaging	Het
Cc2d1a	T	C	8: 84,134,970	D741G	probably damaging	Het
Cct8l1	T	A	5: 25,517,212	N308K	possibly damaging	Het
Cd300ld2	CGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGTCAGAACTGTGGATGGCACAACTGTGCATGGCAGAACTGTGGATGGCACAACTGTGGATGGCAGAACTGTGG	CGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGTCAGAACTGTGGATGGCACAACTGTGCATGGCAGAACTGTGGATGGCACAACTGTGGATGGCAGAACTGTGG	11: 115,012,431		probably benign	Het
Chrna5	T	A	9: 54,998,064	D53E	probably benign	Het
Dap3	A	T	3: 88,928,207		probably null	Het
Disp2	A	G	2: 118,790,008	Y407C	probably damaging	Het
Dnah1	A	G	14: 31,286,814	M2001T	probably benign	Het
Dysf	C	G	6: 84,019,484		probably benign	Het
Eif2ak1	A	T	5: 143,879,446	K187N	probably damaging	Het
Ethe1	T	C	7: 24,595,071	S100P	probably damaging	Het
Fam186a	G	C	15: 99,944,723	I1213M	possibly damaging	Het
Fam205c	TCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGTCATTCAACACTTTGG	TCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGTCATTCAACACTTTGG	4: 42,871,823		probably benign	Het
Gbp9	A	G	5: 105,085,009	F259S	probably damaging	Het
Heatr5b	G	A	17: 78,765,405	H1610Y	possibly damaging	Het
Hk2	T	A	6: 82,728,766	D852V	probably benign	Het
Hmcn1	T	A	1: 150,655,819	Q3233L	possibly damaging	Het
Htt	T	A	5: 34,889,447	V2369E	probably benign	Het
Il9	C	A	13: 56,482,129	E35*	probably null	Het
Jak3	A	G	8: 71,685,520	K872E	possibly damaging	Het
Kcnmb2	A	C	3: 32,198,117	M156L	probably benign	Het
Kdm4a	C	T	4: 118,142,283	V981I	unknown	Het
Klhl38	A	T	15: 58,314,829	*582R	probably null	Het
Map3k19	A	G	1: 127,824,129	F495S	probably damaging	Het
Mpeg1	T	A	19: 12,463,079	W634R	probably damaging	Het
Mrpl4	T	A	9: 21,007,682	Y202N	possibly damaging	Het
Nme8	A	G	13: 19,675,808	V214A	probably damaging	Het
Olfr1080	G	A	2: 86,553,953	T57M	probably damaging	Het
Olfr1280	A	T	2: 111,315,894	R138S	possibly damaging	Het
Pcdhgb6	A	G	18: 37,743,398	I386M	possibly damaging	Het
Pitpnm1	T	A	19: 4,112,356	V1062E	possibly damaging	Het
Plekhm3	G	A	1: 64,883,196	R607W	possibly damaging	Het
Plppr2	TCGCC	TC	9: 21,944,431		probably benign	Het
Prap1	C	A	7: 140,097,069	H141Q	probably damaging	Het
Prep	T	A	10: 45,095,156	Y187*	probably null	Het
Rergl	T	G	6: 139,501,867	E3A	probably benign	Het
Rnf19a	A	T	15: 36,241,875	S673T	probably benign	Het
St18	G	A	1: 6,810,602	E440K	probably damaging	Het
Syne1	T	A	10: 5,359,074	Q645L	probably damaging	Het
Tmcc1	A	T	6: 116,134,137	V61E		Het
Tmcc1	C	A	6: 116,134,138	V61L		Het
Tmem135	G	C	7: 89,147,978	L357V	probably benign	Het
Tmem201	C	A	4: 149,729,681	R154L	possibly damaging	Het
Tmem71	G	A	15: 66,538,806	A239V	possibly damaging	Het
Tpgs2	A	G	18: 25,151,218	W78R	probably damaging	Het
Tssc4	T	C	7: 143,069,699	V22A	unknown	Het
Ttn	T	A	2: 76,867,195	L227F		Het
Ttn	T	A	2: 76,892,784	E6496D	unknown	Het
Vps50	G	T	6: 3,522,338	G169*	probably null	Het
Yy1	CGGCGACCACGGCGGCGGCGGGGGCG	CGGCG	12: 108,793,580		probably benign	Het
Zfp407	T	C	18: 84,343,060	K1703R	probably benign	Het
Zfp616	T	G	11: 74,085,697	C931G	probably damaging	Het
Zfp949	G	A	9: 88,569,364	C329Y	probably damaging	Het
Zswim5	T	A	4: 116,965,690	D452E	probably benign	Het

Other mutations in Itga8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00806:Itga8	APN	2	12255966	nonsense	probably null
IGL00820:Itga8	APN	2	12232892	missense	possibly damaging	0.85
IGL01409:Itga8	APN	2	12191714	missense	probably benign
IGL01508:Itga8	APN	2	12232802	missense	possibly damaging	0.67
IGL01585:Itga8	APN	2	12160312	splice site	probably benign
IGL01590:Itga8	APN	2	12160333	missense	probably damaging	1.00
IGL01743:Itga8	APN	2	12265333	missense	probably benign	0.04
IGL02634:Itga8	APN	2	12140478	missense	possibly damaging	0.55
IGL02805:Itga8	APN	2	12189480	missense	possibly damaging	0.83
IGL03200:Itga8	APN	2	12191199	missense	probably benign	0.00
IGL03218:Itga8	APN	2	12111025	missense	possibly damaging	0.77
IGL03248:Itga8	APN	2	12132516	missense	probably benign	0.20
PIT4576001:Itga8	UTSW	2	12230092	missense	probably benign	0.19
R0196:Itga8	UTSW	2	12204729	critical splice donor site	probably null
R0356:Itga8	UTSW	2	12182721	missense	possibly damaging	0.73
R0466:Itga8	UTSW	2	12232886	missense	probably damaging	1.00
R0530:Itga8	UTSW	2	12191816	missense	probably damaging	0.99
R0715:Itga8	UTSW	2	12191242	splice site	probably benign
R0800:Itga8	UTSW	2	12193551	missense	possibly damaging	0.95
R0881:Itga8	UTSW	2	12262192	splice site	probably null
R1675:Itga8	UTSW	2	12200163	missense	probably damaging	0.99
R1758:Itga8	UTSW	2	12265333	missense	possibly damaging	0.83
R1939:Itga8	UTSW	2	12300846	missense	probably damaging	1.00
R2187:Itga8	UTSW	2	12194420	missense	possibly damaging	0.60
R2295:Itga8	UTSW	2	12182709	missense	probably benign	0.38
R2356:Itga8	UTSW	2	12200141	missense	probably benign
R2371:Itga8	UTSW	2	12253466	missense	probably damaging	1.00
R2412:Itga8	UTSW	2	12301715	missense	probably benign
R2440:Itga8	UTSW	2	12178680	missense	possibly damaging	0.70
R2848:Itga8	UTSW	2	12160404	missense	probably damaging	0.98
R3730:Itga8	UTSW	2	12193510	missense	possibly damaging	0.92
R3933:Itga8	UTSW	2	12189519	missense	probably benign
R3982:Itga8	UTSW	2	12300963	missense	possibly damaging	0.92
R4513:Itga8	UTSW	2	12182736	missense	probably benign	0.01
R4514:Itga8	UTSW	2	12182736	missense	probably benign	0.01
R4660:Itga8	UTSW	2	12265258	missense	probably damaging	1.00
R4890:Itga8	UTSW	2	12193291	splice site	probably benign
R5533:Itga8	UTSW	2	12160350	missense	possibly damaging	0.90
R5619:Itga8	UTSW	2	12265328	missense	probably damaging	1.00
R5720:Itga8	UTSW	2	12111087	missense	probably damaging	0.99
R5749:Itga8	UTSW	2	12262078	missense	probably damaging	1.00
R5930:Itga8	UTSW	2	12230208	missense	possibly damaging	0.84
R5954:Itga8	UTSW	2	12132486	missense	probably damaging	0.99
R6035:Itga8	UTSW	2	12191714	missense	probably benign
R6035:Itga8	UTSW	2	12191714	missense	probably benign
R6211:Itga8	UTSW	2	12193509	missense	probably damaging	1.00
R6337:Itga8	UTSW	2	12253469	nonsense	probably null
R6442:Itga8	UTSW	2	12230143	missense	probably benign	0.00
R6491:Itga8	UTSW	2	12204776	missense	probably damaging	1.00
R6543:Itga8	UTSW	2	12301644	missense	probably damaging	0.99
R6574:Itga8	UTSW	2	12230161	missense	probably benign	0.17
R6760:Itga8	UTSW	2	12301640	missense	probably damaging	1.00
R6858:Itga8	UTSW	2	12200081	missense	probably benign	0.00
R6943:Itga8	UTSW	2	12155371	critical splice donor site	probably null
R7048:Itga8	UTSW	2	12111084	missense	probably damaging	0.99
R7203:Itga8	UTSW	2	12230095	missense	possibly damaging	0.77
R7266:Itga8	UTSW	2	12232901	missense	probably damaging	1.00
R7323:Itga8	UTSW	2	12262129	missense	probably damaging	1.00
R7540:Itga8	UTSW	2	12111037	missense	possibly damaging	0.82
R7637:Itga8	UTSW	2	12109187	missense	probably damaging	1.00
R7748:Itga8	UTSW	2	12230239	missense	possibly damaging	0.80
R7848:Itga8	UTSW	2	12191737	missense	probably damaging	0.99
R8031:Itga8	UTSW	2	12155486	missense	probably benign
R8077:Itga8	UTSW	2	12242433	missense	probably benign	0.09
R8757:Itga8	UTSW	2	12262129	missense	probably damaging	1.00
R8759:Itga8	UTSW	2	12262129	missense	probably damaging	1.00
R8772:Itga8	UTSW	2	12182684	missense	probably damaging	1.00
R8773:Itga8	UTSW	2	12182684	missense	probably damaging	1.00
R8774:Itga8	UTSW	2	12182684	missense	probably damaging	1.00
R8774-TAIL:Itga8	UTSW	2	12182684	missense	probably damaging	1.00
R8775:Itga8	UTSW	2	12182684	missense	probably damaging	1.00
R8775-TAIL:Itga8	UTSW	2	12182684	missense	probably damaging	1.00
R8898:Itga8	UTSW	2	12140395	missense	probably benign	0.05
R8962:Itga8	UTSW	2	12191234	missense	possibly damaging	0.94
R9056:Itga8	UTSW	2	12230208	missense	possibly damaging	0.84
R9155:Itga8	UTSW	2	12189519	missense	probably benign
R9354:Itga8	UTSW	2	12232857	missense	possibly damaging	0.94
R9563:Itga8	UTSW	2	12160408	missense	possibly damaging	0.83
R9589:Itga8	UTSW	2	12232890	missense	probably damaging	1.00
R9663:Itga8	UTSW	2	12191769	missense	probably benign	0.00
Z1176:Itga8	UTSW	2	12247518	missense	probably damaging	1.00
Z1176:Itga8	UTSW	2	12262136	missense	probably benign	0.01
Z1176:Itga8	UTSW	2	12301832	start gained	probably benign
Z1177:Itga8	UTSW	2	12300933	missense	possibly damaging	0.89

Predicted Primers

PCR Primer
(F):5'- AAATTCCTACACACGGTGCT -3'
(R):5'- CCAGGAAATTCAATGTCTCACCATT -3'

Sequencing Primer
(F):5'- ACACGGTGCTCCTCTTTTGGG -3'
(R):5'- AATGTCTCACCATTGCTAACCG -3'

Posted On

2021-04-30