Incidental Mutation 'K3955:Prkcq'
ID 67219
Institutional Source Beutler Lab
Gene Symbol Prkcq
Ensembl Gene ENSMUSG00000026778
Gene Name protein kinase C, theta
Synonyms A130035A12Rik, PKC-theta, PKC theta, PKC-0, Pkcq, PKCtheta
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # K3955 (G3) of strain 706
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 11176922-11306033 bp(+) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) T to C at 11251604 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000100035 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028118] [ENSMUST00000102970]
AlphaFold Q02111
Predicted Effect probably benign
Transcript: ENSMUST00000028118
SMART Domains Protein: ENSMUSP00000028118
Gene: ENSMUSG00000026778

DomainStartEndE-ValueType
PDB:2ENJ|A 3 126 6e-83 PDB
C1 160 209 3.27e-15 SMART
C1 232 281 2.22e-17 SMART
S_TKc 380 634 1.17e-97 SMART
S_TK_X 635 698 2.6e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102970
SMART Domains Protein: ENSMUSP00000100035
Gene: ENSMUSG00000026778

DomainStartEndE-ValueType
PDB:2ENJ|A 3 126 2e-84 PDB
C1 160 209 3.27e-15 SMART
C1 232 281 2.22e-17 SMART
Pfam:Pkinase_Tyr 380 558 2.8e-27 PFAM
Pfam:Pkinase 380 560 2.2e-47 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000114853
SMART Domains Protein: ENSMUSP00000110503
Gene: ENSMUSG00000026778

DomainStartEndE-ValueType
PDB:2ENJ|A 3 126 9e-86 PDB
Blast:C2 6 101 2e-44 BLAST
C1 160 209 3.27e-15 SMART
C1 232 281 2.22e-17 SMART
Pfam:Pkinase 380 465 1.7e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192461
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195207
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195628
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.9%
  • 10x: 97.4%
  • 20x: 94.9%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Protein kinase C (PKC) is a family of serine- and threonine-specific protein kinases that can be activated by calcium and the second messenger diacylglycerol. PKC family members phosphorylate a wide variety of protein targets and are known to be involved in diverse cellular signaling pathways. PKC family members also serve as major receptors for phorbol esters, a class of tumor promoters. Each member of the PKC family has a specific expression profile and is believed to play a distinct role. The protein encoded by this gene is one of the PKC family members. It is a calcium-independent and phospholipid-dependent protein kinase. This kinase is important for T-cell activation. It is required for the activation of the transcription factors NF-kappaB and AP-1, and may link the T cell receptor (TCR) signaling complex to the activation of the transcription factors. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit reduced T cell proliferative responses and interleukin 2 production and a lack of T cell receptor-initiated NF-kappaB activation in mature T lymphocytes. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted, knock-out(2) Targeted, other(1)

Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agap1 G A 1: 89,815,326 (GRCm39) R738H probably damaging Het
Arhgap28 T C 17: 68,311,001 (GRCm39) E2G probably damaging Het
Atad2b C A 12: 5,004,536 (GRCm39) probably benign Het
Atmin T A 8: 117,683,775 (GRCm39) C478* probably null Het
Calr T C 8: 85,572,902 (GRCm39) Y57C probably damaging Het
Cdh13 G A 8: 119,401,843 (GRCm39) V82M probably damaging Het
Ces3a A T 8: 105,777,259 (GRCm39) probably benign Het
Dmbt1 T C 7: 130,721,293 (GRCm39) Y1854H probably damaging Het
Dnah1 T A 14: 30,988,416 (GRCm39) M3429L probably benign Het
Dscam A G 16: 96,474,887 (GRCm39) F1225S probably benign Het
E030025P04Rik G A 11: 109,034,778 (GRCm39) P37S unknown Het
Eral1 A T 11: 77,966,847 (GRCm39) D189E probably damaging Het
Fbxw14 G T 9: 109,105,313 (GRCm39) P284Q possibly damaging Het
Fcrl6 A G 1: 172,425,251 (GRCm39) V260A probably benign Het
Fezf2 A T 14: 12,345,097 (GRCm38) F30Y probably damaging Het
Gjb4 A T 4: 127,245,293 (GRCm39) V216D probably benign Het
Gm9758 G A 5: 14,963,522 (GRCm39) probably benign Het
Gm9758 C G 5: 14,963,553 (GRCm39) V92L probably benign Het
Gmps A C 3: 63,908,954 (GRCm39) R485S probably damaging Het
Gtdc1 C T 2: 44,642,233 (GRCm39) probably null Het
H2-Ob C T 17: 34,460,158 (GRCm39) R19C probably damaging Het
Lars2 T C 9: 123,206,842 (GRCm39) V103A probably damaging Het
Mtrex A C 13: 113,047,513 (GRCm39) Y277* probably null Het
Ndnf G A 6: 65,678,413 (GRCm39) probably benign Het
Nectin1 A G 9: 43,703,375 (GRCm39) Y211C probably damaging Het
Notch4 C T 17: 34,787,436 (GRCm39) T332I probably damaging Het
Or13c25 A G 4: 52,911,081 (GRCm39) F238L probably damaging Het
Or8g28 A C 9: 39,169,926 (GRCm39) L14W probably damaging Het
Or8g53 A G 9: 39,683,469 (GRCm39) I209T probably benign Het
Paf1 T C 7: 28,096,350 (GRCm39) probably null Het
Pcdhb1 G T 18: 37,399,026 (GRCm39) G326C probably damaging Het
Plcl1 A G 1: 55,737,098 (GRCm39) Y813C possibly damaging Het
Pramel25 T C 4: 143,521,710 (GRCm39) I442T possibly damaging Het
Proser3 G T 7: 30,242,924 (GRCm39) P218T probably damaging Het
Rccd1 G A 7: 79,970,419 (GRCm39) S66F probably benign Het
Recql G T 6: 142,323,932 (GRCm39) S54* probably null Het
Samd15 G T 12: 87,247,534 (GRCm39) G73V probably benign Het
Siglec1 T C 2: 130,923,359 (GRCm39) N462S probably benign Het
Syne2 G T 12: 75,977,439 (GRCm39) A1296S probably damaging Het
Tlk1 T C 2: 70,552,045 (GRCm39) E542G possibly damaging Het
Tnks1bp1 C T 2: 84,892,755 (GRCm39) T232I probably benign Het
Tnrc6c T A 11: 117,651,564 (GRCm39) Y1696N probably damaging Het
Uggt1 A G 1: 36,201,434 (GRCm39) I1102T probably benign Het
Vmn1r84 C T 7: 12,095,884 (GRCm39) V270M probably damaging Het
Wasf1 C T 10: 40,812,191 (GRCm39) P327S unknown Het
Other mutations in Prkcq
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01654:Prkcq APN 2 11,288,654 (GRCm39) missense probably damaging 1.00
IGL01656:Prkcq APN 2 11,231,766 (GRCm39) missense probably damaging 1.00
IGL01732:Prkcq APN 2 11,265,644 (GRCm39) splice site probably benign
IGL02136:Prkcq APN 2 11,265,479 (GRCm39) missense probably benign 0.00
IGL02161:Prkcq APN 2 11,281,887 (GRCm39) missense probably benign
IGL02178:Prkcq APN 2 11,281,851 (GRCm39) missense possibly damaging 0.93
IGL03107:Prkcq APN 2 11,265,597 (GRCm39) missense probably damaging 1.00
IGL03149:Prkcq APN 2 11,237,356 (GRCm39) missense probably benign 0.11
banks UTSW 2 11,304,221 (GRCm39) missense probably damaging 1.00
celina UTSW 2 11,288,660 (GRCm39) missense possibly damaging 0.82
celina2 UTSW 2 11,231,797 (GRCm39) critical splice donor site probably null
Megabytes UTSW 2 11,295,262 (GRCm39) nonsense probably null
Monmouth UTSW 2 11,284,335 (GRCm39) missense probably damaging 1.00
3-1:Prkcq UTSW 2 11,304,905 (GRCm39) missense probably damaging 1.00
R0049:Prkcq UTSW 2 11,288,643 (GRCm39) missense probably benign 0.04
R0049:Prkcq UTSW 2 11,288,643 (GRCm39) missense probably benign 0.04
R0183:Prkcq UTSW 2 11,257,973 (GRCm39) missense probably damaging 1.00
R0366:Prkcq UTSW 2 11,251,649 (GRCm39) splice site probably benign
R0388:Prkcq UTSW 2 11,259,045 (GRCm39) missense probably benign
R1385:Prkcq UTSW 2 11,261,097 (GRCm39) missense probably damaging 1.00
R1687:Prkcq UTSW 2 11,295,344 (GRCm39) missense probably damaging 1.00
R1693:Prkcq UTSW 2 11,259,010 (GRCm39) missense probably damaging 0.99
R1760:Prkcq UTSW 2 11,304,881 (GRCm39) missense probably damaging 1.00
R1764:Prkcq UTSW 2 11,237,442 (GRCm39) missense probably damaging 1.00
R1968:Prkcq UTSW 2 11,250,208 (GRCm39) missense probably damaging 1.00
R2020:Prkcq UTSW 2 11,284,332 (GRCm39) missense probably benign
R2108:Prkcq UTSW 2 11,237,380 (GRCm39) missense probably damaging 1.00
R2762:Prkcq UTSW 2 11,237,451 (GRCm39) missense possibly damaging 0.75
R3402:Prkcq UTSW 2 11,288,660 (GRCm39) missense possibly damaging 0.82
R3429:Prkcq UTSW 2 11,251,781 (GRCm39) missense probably damaging 1.00
R3545:Prkcq UTSW 2 11,288,627 (GRCm39) missense probably benign 0.11
R3547:Prkcq UTSW 2 11,288,627 (GRCm39) missense probably benign 0.11
R3893:Prkcq UTSW 2 11,231,782 (GRCm39) missense probably damaging 1.00
R4086:Prkcq UTSW 2 11,288,679 (GRCm39) missense probably damaging 0.97
R4423:Prkcq UTSW 2 11,260,980 (GRCm39) missense possibly damaging 0.66
R4541:Prkcq UTSW 2 11,288,623 (GRCm39) missense possibly damaging 0.84
R4649:Prkcq UTSW 2 11,284,333 (GRCm39) missense possibly damaging 0.83
R4652:Prkcq UTSW 2 11,284,333 (GRCm39) missense possibly damaging 0.83
R4820:Prkcq UTSW 2 11,231,797 (GRCm39) critical splice donor site probably null
R5197:Prkcq UTSW 2 11,304,227 (GRCm39) missense probably damaging 1.00
R6008:Prkcq UTSW 2 11,261,097 (GRCm39) missense probably damaging 1.00
R7030:Prkcq UTSW 2 11,231,661 (GRCm39) splice site probably null
R7231:Prkcq UTSW 2 11,295,262 (GRCm39) nonsense probably null
R7461:Prkcq UTSW 2 11,304,221 (GRCm39) missense probably damaging 1.00
R7613:Prkcq UTSW 2 11,304,221 (GRCm39) missense probably damaging 1.00
R8441:Prkcq UTSW 2 11,253,037 (GRCm39) missense probably benign 0.11
R8491:Prkcq UTSW 2 11,284,335 (GRCm39) missense probably damaging 1.00
R8724:Prkcq UTSW 2 11,304,784 (GRCm39) missense probably benign 0.17
R9031:Prkcq UTSW 2 11,251,819 (GRCm39) missense probably damaging 0.99
R9164:Prkcq UTSW 2 11,231,716 (GRCm39) missense probably damaging 0.96
R9621:Prkcq UTSW 2 11,261,014 (GRCm39) missense probably benign 0.00
R9661:Prkcq UTSW 2 11,250,141 (GRCm39) nonsense probably null
Z1177:Prkcq UTSW 2 11,304,192 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- ACGCCCTTTGAACAAGGCAGTG -3'
(R):5'- AACCGAACCCTGATGATAGTGCCC -3'

Sequencing Primer
(F):5'- ATTGCTAGGAGCCTGTGATACAC -3'
(R):5'- GATGATAGTGCCCCCTTGAAC -3'
Posted On 2013-09-03