Incidental Mutation 'R8808:1110002E22Rik'
ID 672200
Institutional Source Beutler Lab
Gene Symbol 1110002E22Rik
Ensembl Gene ENSMUSG00000090066
Gene Name RIKEN cDNA 1110002E22 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.576) question?
Stock # R8808 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 138065052-138081506 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 138070113 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Proline to Serine at position 1688 (P1688S)
Ref Sequence ENSEMBL: ENSMUSP00000123851 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053318] [ENSMUST00000163080]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000053318
Predicted Effect probably benign
Transcript: ENSMUST00000163080
AA Change: P1688S

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000123851
Gene: ENSMUSG00000090066
AA Change: P1688S

DomainStartEndE-ValueType
low complexity region 44 55 N/A INTRINSIC
low complexity region 87 102 N/A INTRINSIC
low complexity region 229 247 N/A INTRINSIC
low complexity region 422 438 N/A INTRINSIC
low complexity region 459 505 N/A INTRINSIC
low complexity region 667 680 N/A INTRINSIC
low complexity region 937 948 N/A INTRINSIC
low complexity region 995 1007 N/A INTRINSIC
low complexity region 1105 1115 N/A INTRINSIC
low complexity region 1224 1242 N/A INTRINSIC
low complexity region 1376 1385 N/A INTRINSIC
Pfam:DUF4585 1598 1667 6.9e-32 PFAM
low complexity region 1723 1738 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 95% (60/63)
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933412E24Rik T C 15: 60,016,070 T174A probably benign Het
Actl10 T A 2: 154,553,148 L340Q probably damaging Het
Adra1d T C 2: 131,561,477 E231G probably damaging Het
Agt T A 8: 124,564,289 D93V probably benign Het
Als2cl G T 9: 110,889,214 R341L possibly damaging Het
Ankrd63 G T 2: 118,703,068 A124E unknown Het
Aqp8 T C 7: 123,466,699 L239P probably damaging Het
Arhgef11 A G 3: 87,686,029 E85G probably damaging Het
Cacng4 T A 11: 107,794,383 I28F possibly damaging Het
Cc2d1a T C 8: 84,134,970 D741G probably damaging Het
Cct8l1 T A 5: 25,517,212 N308K possibly damaging Het
Cd300ld2 CGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGTCAGAACTGTGGATGGCACAACTGTGCATGGCAGAACTGTGGATGGCACAACTGTGGATGGCAGAACTGTGG CGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGTCAGAACTGTGGATGGCACAACTGTGCATGGCAGAACTGTGGATGGCACAACTGTGGATGGCAGAACTGTGG 11: 115,012,431 probably benign Het
Chrna5 T A 9: 54,998,064 D53E probably benign Het
Dap3 A T 3: 88,928,207 probably null Het
Disp2 A G 2: 118,790,008 Y407C probably damaging Het
Dnah1 A G 14: 31,286,814 M2001T probably benign Het
Dysf C G 6: 84,019,484 probably benign Het
Eif2ak1 A T 5: 143,879,446 K187N probably damaging Het
Ethe1 T C 7: 24,595,071 S100P probably damaging Het
Fam186a G C 15: 99,944,723 I1213M possibly damaging Het
Fam205c TCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGTCATTCAACACTTTGG TCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGTCATTCAACACTTTGG 4: 42,871,823 probably benign Het
Gbp9 A G 5: 105,085,009 F259S probably damaging Het
Heatr5b G A 17: 78,765,405 H1610Y possibly damaging Het
Hk2 T A 6: 82,728,766 D852V probably benign Het
Hmcn1 T A 1: 150,655,819 Q3233L possibly damaging Het
Htt T A 5: 34,889,447 V2369E probably benign Het
Il9 C A 13: 56,482,129 E35* probably null Het
Itga8 A T 2: 12,132,517 C933* probably null Het
Jak3 A G 8: 71,685,520 K872E possibly damaging Het
Kcnmb2 A C 3: 32,198,117 M156L probably benign Het
Kdm4a C T 4: 118,142,283 V981I unknown Het
Klhl38 A T 15: 58,314,829 *582R probably null Het
Map3k19 A G 1: 127,824,129 F495S probably damaging Het
Mpeg1 T A 19: 12,463,079 W634R probably damaging Het
Mrpl4 T A 9: 21,007,682 Y202N possibly damaging Het
Nme8 A G 13: 19,675,808 V214A probably damaging Het
Olfr1080 G A 2: 86,553,953 T57M probably damaging Het
Olfr1280 A T 2: 111,315,894 R138S possibly damaging Het
Pcdhgb6 A G 18: 37,743,398 I386M possibly damaging Het
Pitpnm1 T A 19: 4,112,356 V1062E possibly damaging Het
Plekhm3 G A 1: 64,883,196 R607W possibly damaging Het
Plppr2 TCGCC TC 9: 21,944,431 probably benign Het
Prap1 C A 7: 140,097,069 H141Q probably damaging Het
Prep T A 10: 45,095,156 Y187* probably null Het
Rergl T G 6: 139,501,867 E3A probably benign Het
Rnf19a A T 15: 36,241,875 S673T probably benign Het
St18 G A 1: 6,810,602 E440K probably damaging Het
Syne1 T A 10: 5,359,074 Q645L probably damaging Het
Tmcc1 A T 6: 116,134,137 V61E Het
Tmcc1 C A 6: 116,134,138 V61L Het
Tmem135 G C 7: 89,147,978 L357V probably benign Het
Tmem201 C A 4: 149,729,681 R154L possibly damaging Het
Tmem71 G A 15: 66,538,806 A239V possibly damaging Het
Tpgs2 A G 18: 25,151,218 W78R probably damaging Het
Tssc4 T C 7: 143,069,699 V22A unknown Het
Ttn T A 2: 76,867,195 L227F Het
Ttn T A 2: 76,892,784 E6496D unknown Het
Vps50 G T 6: 3,522,338 G169* probably null Het
Yy1 CGGCGACCACGGCGGCGGCGGGGGCG CGGCG 12: 108,793,580 probably benign Het
Zfp407 T C 18: 84,343,060 K1703R probably benign Het
Zfp616 T G 11: 74,085,697 C931G probably damaging Het
Zfp949 G A 9: 88,569,364 C329Y probably damaging Het
Zswim5 T A 4: 116,965,690 D452E probably benign Het
Other mutations in 1110002E22Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0026:1110002E22Rik UTSW 3 138066805 missense possibly damaging 0.95
R0047:1110002E22Rik UTSW 3 138066264 missense probably damaging 0.97
R0047:1110002E22Rik UTSW 3 138066264 missense probably damaging 0.97
R0102:1110002E22Rik UTSW 3 138068113 missense probably damaging 1.00
R0102:1110002E22Rik UTSW 3 138068113 missense probably damaging 1.00
R0197:1110002E22Rik UTSW 3 138069871 missense probably damaging 1.00
R0239:1110002E22Rik UTSW 3 138065834 small deletion probably benign
R0394:1110002E22Rik UTSW 3 138067304 missense probably damaging 0.99
R0401:1110002E22Rik UTSW 3 138070306 missense possibly damaging 0.73
R0496:1110002E22Rik UTSW 3 138068244 missense probably damaging 1.00
R0591:1110002E22Rik UTSW 3 138068943 nonsense probably null
R0711:1110002E22Rik UTSW 3 138068225 missense probably damaging 0.99
R0883:1110002E22Rik UTSW 3 138069871 missense probably damaging 1.00
R0908:1110002E22Rik UTSW 3 138070077 missense probably damaging 0.99
R0968:1110002E22Rik UTSW 3 138067206 missense probably damaging 0.99
R1023:1110002E22Rik UTSW 3 138066871 missense probably damaging 1.00
R1168:1110002E22Rik UTSW 3 138067900 missense probably benign 0.20
R1472:1110002E22Rik UTSW 3 138067552 missense possibly damaging 0.95
R1538:1110002E22Rik UTSW 3 138065401 missense probably benign 0.02
R1648:1110002E22Rik UTSW 3 138069420 missense probably benign 0.18
R1800:1110002E22Rik UTSW 3 138066718 missense probably damaging 1.00
R1919:1110002E22Rik UTSW 3 138067270 missense probably damaging 0.99
R1974:1110002E22Rik UTSW 3 138067267 missense probably damaging 1.00
R1990:1110002E22Rik UTSW 3 138065658 nonsense probably null
R1991:1110002E22Rik UTSW 3 138065658 nonsense probably null
R2102:1110002E22Rik UTSW 3 138065173 missense probably damaging 0.99
R2761:1110002E22Rik UTSW 3 138067780 missense probably damaging 0.99
R2899:1110002E22Rik UTSW 3 138065682 missense probably benign 0.00
R3618:1110002E22Rik UTSW 3 138068407 missense probably damaging 1.00
R3904:1110002E22Rik UTSW 3 138066639 missense probably benign 0.15
R3955:1110002E22Rik UTSW 3 138068073 missense probably benign 0.00
R4520:1110002E22Rik UTSW 3 138070266 missense probably damaging 0.99
R4619:1110002E22Rik UTSW 3 138069759 missense probably damaging 0.99
R4736:1110002E22Rik UTSW 3 138068485 missense probably damaging 0.99
R4752:1110002E22Rik UTSW 3 138069990 missense possibly damaging 0.91
R4777:1110002E22Rik UTSW 3 138065742 missense probably benign 0.09
R4780:1110002E22Rik UTSW 3 138065370 missense probably benign 0.02
R4824:1110002E22Rik UTSW 3 138065676 missense probably benign 0.00
R4829:1110002E22Rik UTSW 3 138069019 missense probably damaging 0.99
R4965:1110002E22Rik UTSW 3 138069672 missense probably benign
R5206:1110002E22Rik UTSW 3 138066511 missense probably benign 0.00
R5212:1110002E22Rik UTSW 3 138065850 missense possibly damaging 0.85
R5373:1110002E22Rik UTSW 3 138067635 missense probably benign
R5374:1110002E22Rik UTSW 3 138067635 missense probably benign
R5506:1110002E22Rik UTSW 3 138067947 missense probably damaging 1.00
R5528:1110002E22Rik UTSW 3 138066499 missense probably benign
R5536:1110002E22Rik UTSW 3 138066388 missense possibly damaging 0.89
R5587:1110002E22Rik UTSW 3 138065409 missense probably benign
R5759:1110002E22Rik UTSW 3 138068658 missense probably benign
R5933:1110002E22Rik UTSW 3 138070348 missense probably damaging 1.00
R5957:1110002E22Rik UTSW 3 138070161 missense probably benign
R6092:1110002E22Rik UTSW 3 138068940 missense probably benign 0.02
R6305:1110002E22Rik UTSW 3 138067980 missense probably damaging 1.00
R6457:1110002E22Rik UTSW 3 138066622 missense probably damaging 1.00
R6469:1110002E22Rik UTSW 3 138066975 missense probably damaging 0.97
R6499:1110002E22Rik UTSW 3 138068800 missense probably damaging 1.00
R6527:1110002E22Rik UTSW 3 138067527 missense probably damaging 0.99
R6580:1110002E22Rik UTSW 3 138066625 missense probably benign 0.00
R6693:1110002E22Rik UTSW 3 138069154 missense probably benign 0.00
R6751:1110002E22Rik UTSW 3 138066210 missense probably damaging 1.00
R6852:1110002E22Rik UTSW 3 138065169 nonsense probably null
R6920:1110002E22Rik UTSW 3 138068050 missense probably damaging 1.00
R7001:1110002E22Rik UTSW 3 138065511 missense probably benign
R7145:1110002E22Rik UTSW 3 138070059 missense probably damaging 1.00
R7238:1110002E22Rik UTSW 3 138069951 missense probably damaging 1.00
R7278:1110002E22Rik UTSW 3 138065476 missense probably benign
R7425:1110002E22Rik UTSW 3 138065695 missense probably benign 0.00
R7487:1110002E22Rik UTSW 3 138066868 missense probably damaging 1.00
R7557:1110002E22Rik UTSW 3 138068283 nonsense probably null
R7663:1110002E22Rik UTSW 3 138066126 missense probably damaging 0.98
R7743:1110002E22Rik UTSW 3 138068755 missense probably damaging 1.00
R7799:1110002E22Rik UTSW 3 138069601 missense probably benign 0.33
R8181:1110002E22Rik UTSW 3 138068395 missense probably damaging 0.99
R8264:1110002E22Rik UTSW 3 138067782 missense probably damaging 0.99
R8273:1110002E22Rik UTSW 3 138066450 missense probably benign
R8434:1110002E22Rik UTSW 3 138067260 missense probably damaging 0.97
R8530:1110002E22Rik UTSW 3 138068825 missense probably damaging 0.99
R8754:1110002E22Rik UTSW 3 138066037 missense probably benign
R8891:1110002E22Rik UTSW 3 138066759 nonsense probably null
R9026:1110002E22Rik UTSW 3 138065148 missense possibly damaging 0.53
R9177:1110002E22Rik UTSW 3 138069916 missense probably damaging 1.00
R9250:1110002E22Rik UTSW 3 138066628 missense probably damaging 1.00
R9291:1110002E22Rik UTSW 3 138066703 missense probably benign 0.02
R9293:1110002E22Rik UTSW 3 138066078 missense possibly damaging 0.93
R9307:1110002E22Rik UTSW 3 138065422 missense probably benign 0.04
R9439:1110002E22Rik UTSW 3 138066287 missense probably benign 0.00
X0003:1110002E22Rik UTSW 3 138069096 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGATTGTTTGACCCCGAGACAG -3'
(R):5'- AGGTGATGCTGATGACAGGC -3'

Sequencing Primer
(F):5'- GGGCAATACGTGGATGTGCC -3'
(R):5'- ATGCTGATGACAGGCTTGCC -3'
Posted On 2021-04-30