Incidental Mutation 'R8808:Rergl'
ID672214
Institutional Source Beutler Lab
Gene Symbol Rergl
Ensembl Gene ENSMUSG00000092164
Gene NameRERG/RAS-like
SynonymsEG632971
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R8808 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location139492973-139501976 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 139501867 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Alanine at position 3 (E3A)
Ref Sequence ENSEMBL: ENSMUSP00000131303 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170650]
Predicted Effect probably benign
Transcript: ENSMUST00000170650
AA Change: E3A

PolyPhen 2 Score 0.184 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000131303
Gene: ENSMUSG00000092164
AA Change: E3A

DomainStartEndE-ValueType
Pfam:Ras 5 173 7.7e-30 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik C T 3: 138,070,113 P1688S probably benign Het
4933412E24Rik T C 15: 60,016,070 T174A probably benign Het
Actl10 T A 2: 154,553,148 L340Q probably damaging Het
Adra1d T C 2: 131,561,477 E231G probably damaging Het
Agt T A 8: 124,564,289 D93V probably benign Het
Als2cl G T 9: 110,889,214 R341L possibly damaging Het
Ankrd63 G T 2: 118,703,068 A124E unknown Het
Aqp8 T C 7: 123,466,699 L239P probably damaging Het
Arhgef11 A G 3: 87,686,029 E85G probably damaging Het
Cacng4 T A 11: 107,794,383 I28F possibly damaging Het
Cc2d1a T C 8: 84,134,970 D741G probably damaging Het
Cct8l1 T A 5: 25,517,212 N308K possibly damaging Het
Cd300ld2 CGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGTCAGAACTGTGGATGGCACAACTGTGCATGGCAGAACTGTGGATGGCACAACTGTGGATGGCAGAACTGTGG CGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGTCAGAACTGTGGATGGCACAACTGTGCATGGCAGAACTGTGGATGGCACAACTGTGGATGGCAGAACTGTGG 11: 115,012,431 probably benign Het
Chrna5 T A 9: 54,998,064 D53E probably benign Het
Dap3 A T 3: 88,928,207 probably null Het
Disp2 A G 2: 118,790,008 Y407C probably damaging Het
Dnah1 A G 14: 31,286,814 M2001T probably benign Het
Dysf C G 6: 84,019,484 probably benign Het
Eif2ak1 A T 5: 143,879,446 K187N probably damaging Het
Ethe1 T C 7: 24,595,071 S100P probably damaging Het
Fam186a G C 15: 99,944,723 I1213M possibly damaging Het
Fam205c TCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGTCATTCAACACTTTGG TCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGTCATTCAACACTTTGG 4: 42,871,823 probably benign Het
Gbp9 A G 5: 105,085,009 F259S probably damaging Het
Heatr5b G A 17: 78,765,405 H1610Y possibly damaging Het
Hk2 T A 6: 82,728,766 D852V probably benign Het
Hmcn1 T A 1: 150,655,819 Q3233L possibly damaging Het
Htt T A 5: 34,889,447 V2369E probably benign Het
Il9 C A 13: 56,482,129 E35* probably null Het
Itga8 A T 2: 12,132,517 C933* probably null Het
Jak3 A G 8: 71,685,520 K872E possibly damaging Het
Kcnmb2 A C 3: 32,198,117 M156L probably benign Het
Kdm4a C T 4: 118,142,283 V981I unknown Het
Klhl38 A T 15: 58,314,829 *582R probably null Het
Map3k19 A G 1: 127,824,129 F495S probably damaging Het
Mpeg1 T A 19: 12,463,079 W634R probably damaging Het
Mrpl4 T A 9: 21,007,682 Y202N possibly damaging Het
Nme8 A G 13: 19,675,808 V214A probably damaging Het
Olfr1080 G A 2: 86,553,953 T57M probably damaging Het
Olfr1280 A T 2: 111,315,894 R138S possibly damaging Het
Pcdhgb6 A G 18: 37,743,398 I386M possibly damaging Het
Pitpnm1 T A 19: 4,112,356 V1062E possibly damaging Het
Plekhm3 G A 1: 64,883,196 R607W possibly damaging Het
Plppr2 TCGCC TC 9: 21,944,431 probably benign Het
Prap1 C A 7: 140,097,069 H141Q probably damaging Het
Prep T A 10: 45,095,156 Y187* probably null Het
Rnf19a A T 15: 36,241,875 S673T probably benign Het
St18 G A 1: 6,810,602 E440K probably damaging Het
Syne1 T A 10: 5,359,074 Q645L probably damaging Het
Tmcc1 A T 6: 116,134,137 V61E Het
Tmcc1 C A 6: 116,134,138 V61L Het
Tmem135 G C 7: 89,147,978 L357V probably benign Het
Tmem201 C A 4: 149,729,681 R154L possibly damaging Het
Tmem71 G A 15: 66,538,806 A239V possibly damaging Het
Tpgs2 A G 18: 25,151,218 W78R probably damaging Het
Tssc4 T C 7: 143,069,699 V22A unknown Het
Ttn T A 2: 76,867,195 L227F Het
Ttn T A 2: 76,892,784 E6496D unknown Het
Vps50 G T 6: 3,522,338 G169* probably null Het
Yy1 CGGCGACCACGGCGGCGGCGGGGGCG CGGCG 12: 108,793,580 probably benign Het
Zfp407 T C 18: 84,343,060 K1703R probably benign Het
Zfp616 T G 11: 74,085,697 C931G probably damaging Het
Zfp949 G A 9: 88,569,364 C329Y probably damaging Het
Zswim5 T A 4: 116,965,690 D452E probably benign Het
Other mutations in Rergl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01309:Rergl APN 6 139493258 nonsense probably null
IGL01542:Rergl APN 6 139493498 critical splice acceptor site probably null
IGL01761:Rergl APN 6 139501865 missense probably damaging 0.96
IGL02236:Rergl APN 6 139494920 missense probably benign 0.25
IGL02507:Rergl APN 6 139493353 missense probably damaging 1.00
IGL02523:Rergl APN 6 139496460 splice site probably benign
R0518:Rergl UTSW 6 139496526 missense probably damaging 1.00
R0521:Rergl UTSW 6 139496526 missense probably damaging 1.00
R2086:Rergl UTSW 6 139494834 missense probably benign
R4629:Rergl UTSW 6 139501852 missense probably damaging 1.00
R5275:Rergl UTSW 6 139501821 critical splice donor site probably null
R6364:Rergl UTSW 6 139500748 missense probably damaging 1.00
R7175:Rergl UTSW 6 139496535 missense probably benign 0.01
Z1088:Rergl UTSW 6 139493426 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACCTGCCCAGAAGATTGAAAATG -3'
(R):5'- AGAGGATTATGAATGGGACTTCTG -3'

Sequencing Primer
(F):5'- TGCCCAGAAGATTGAAAATGCATAC -3'
(R):5'- CTGTTGAAATGTACCAAAAGCAAACG -3'
Posted On2021-04-30