Incidental Mutation 'K3955:Tnks1bp1'
ID67222
Institutional Source Beutler Lab
Gene Symbol Tnks1bp1
Ensembl Gene ENSMUSG00000033955
Gene Nametankyrase 1 binding protein 1
SynonymsTAB182
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #K3955 (G3) of strain 706
Quality Score225
Status Validated
Chromosome2
Chromosomal Location85048022-85073048 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 85062411 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 232 (T232I)
Ref Sequence ENSEMBL: ENSMUSP00000045767 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048400] [ENSMUST00000111605]
Predicted Effect probably benign
Transcript: ENSMUST00000048400
AA Change: T232I

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000045767
Gene: ENSMUSG00000033955
AA Change: T232I

DomainStartEndE-ValueType
low complexity region 77 96 N/A INTRINSIC
low complexity region 292 298 N/A INTRINSIC
low complexity region 809 827 N/A INTRINSIC
low complexity region 868 875 N/A INTRINSIC
Tankyrase_bdg_C 883 1055 1.98e-79 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111605
AA Change: T894I

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000107232
Gene: ENSMUSG00000033955
AA Change: T894I

DomainStartEndE-ValueType
low complexity region 37 44 N/A INTRINSIC
low complexity region 59 72 N/A INTRINSIC
low complexity region 296 316 N/A INTRINSIC
low complexity region 380 391 N/A INTRINSIC
low complexity region 496 518 N/A INTRINSIC
low complexity region 739 758 N/A INTRINSIC
low complexity region 954 960 N/A INTRINSIC
low complexity region 1471 1489 N/A INTRINSIC
low complexity region 1530 1537 N/A INTRINSIC
Tankyrase_bdg_C 1545 1717 1.98e-79 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126309
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148682
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151092
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.9%
  • 10x: 97.4%
  • 20x: 94.9%
Validation Efficiency 100% (42/42)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agap1 G A 1: 89,887,604 R738H probably damaging Het
Arhgap28 T C 17: 68,004,006 E2G probably damaging Het
Atad2b C A 12: 4,954,536 probably benign Het
Atmin T A 8: 116,957,036 C478* probably null Het
Calr T C 8: 84,846,273 Y57C probably damaging Het
Cdh13 G A 8: 118,675,104 V82M probably damaging Het
Ces3a A T 8: 105,050,627 probably benign Het
Dmbt1 T C 7: 131,119,564 Y1854H probably damaging Het
Dnah1 T A 14: 31,266,459 M3429L probably benign Het
Dscam A G 16: 96,673,687 F1225S probably benign Het
E030025P04Rik G A 11: 109,143,952 P37S unknown Het
Eral1 A T 11: 78,076,021 D189E probably damaging Het
Fbxw14 G T 9: 109,276,245 P284Q possibly damaging Het
Fcrl6 A G 1: 172,597,684 V260A probably benign Het
Fezf2 A T 14: 12,345,097 F30Y probably damaging Het
Gjb4 A T 4: 127,351,500 V216D probably benign Het
Gm13023 T C 4: 143,795,140 I442T possibly damaging Het
Gm9758 G A 5: 14,913,508 probably benign Het
Gm9758 C G 5: 14,913,539 V92L probably benign Het
Gmps A C 3: 64,001,533 R485S probably damaging Het
Gtdc1 C T 2: 44,752,221 probably null Het
H2-Ob C T 17: 34,241,184 R19C probably damaging Het
Lars2 T C 9: 123,377,777 V103A probably damaging Het
Ndnf G A 6: 65,701,429 probably benign Het
Nectin1 A G 9: 43,792,078 Y211C probably damaging Het
Notch4 C T 17: 34,568,462 T332I probably damaging Het
Olfr272 A G 4: 52,911,081 F238L probably damaging Het
Olfr945 A C 9: 39,258,630 L14W probably damaging Het
Olfr968 A G 9: 39,772,173 I209T probably benign Het
Paf1 T C 7: 28,396,925 probably null Het
Pcdhb1 G T 18: 37,265,973 G326C probably damaging Het
Plcl1 A G 1: 55,697,939 Y813C possibly damaging Het
Prkcq T C 2: 11,246,793 probably benign Het
Proser3 G T 7: 30,543,499 P218T probably damaging Het
Rccd1 G A 7: 80,320,671 S66F probably benign Het
Recql G T 6: 142,378,206 S54* probably null Het
Samd15 G T 12: 87,200,760 G73V probably benign Het
Siglec1 T C 2: 131,081,439 N462S probably benign Het
Skiv2l2 A C 13: 112,910,979 Y277* probably null Het
Syne2 G T 12: 75,930,665 A1296S probably damaging Het
Tlk1 T C 2: 70,721,701 E542G possibly damaging Het
Tnrc6c T A 11: 117,760,738 Y1696N probably damaging Het
Uggt1 A G 1: 36,162,353 I1102T probably benign Het
Vmn1r84 C T 7: 12,361,957 V270M probably damaging Het
Wasf1 C T 10: 40,936,195 P327S unknown Het
Other mutations in Tnks1bp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00870:Tnks1bp1 APN 2 85062236 nonsense probably null
IGL00974:Tnks1bp1 APN 2 85062882 missense possibly damaging 0.92
IGL01874:Tnks1bp1 APN 2 85058447 missense probably benign 0.01
IGL02419:Tnks1bp1 APN 2 85071781 missense possibly damaging 0.60
IGL02441:Tnks1bp1 APN 2 85071799 missense probably damaging 1.00
IGL02475:Tnks1bp1 APN 2 85059377 missense probably damaging 1.00
IGL03181:Tnks1bp1 APN 2 85062714 missense probably benign 0.00
P0038:Tnks1bp1 UTSW 2 85062411 missense probably benign 0.01
PIT4791001:Tnks1bp1 UTSW 2 85062558 missense probably benign 0.03
R0068:Tnks1bp1 UTSW 2 85062352 missense probably benign 0.12
R0068:Tnks1bp1 UTSW 2 85062352 missense probably benign 0.12
R0164:Tnks1bp1 UTSW 2 85059221 missense possibly damaging 0.94
R0164:Tnks1bp1 UTSW 2 85059221 missense possibly damaging 0.94
R0189:Tnks1bp1 UTSW 2 85070929 missense possibly damaging 0.77
R0454:Tnks1bp1 UTSW 2 85072137 missense probably damaging 1.00
R0650:Tnks1bp1 UTSW 2 85062630 missense possibly damaging 0.68
R0737:Tnks1bp1 UTSW 2 85052536 missense possibly damaging 0.93
R1718:Tnks1bp1 UTSW 2 85071738 missense probably benign 0.44
R1749:Tnks1bp1 UTSW 2 85063067 missense probably benign
R2194:Tnks1bp1 UTSW 2 85063065 missense probably benign 0.06
R2314:Tnks1bp1 UTSW 2 85058915 missense probably benign 0.01
R2379:Tnks1bp1 UTSW 2 85063838 missense probably benign 0.16
R3056:Tnks1bp1 UTSW 2 85070000 nonsense probably null
R3433:Tnks1bp1 UTSW 2 85071016 splice site probably benign
R3751:Tnks1bp1 UTSW 2 85058722 start gained probably benign
R4502:Tnks1bp1 UTSW 2 85062647 nonsense probably null
R4694:Tnks1bp1 UTSW 2 85071722 missense probably damaging 1.00
R4785:Tnks1bp1 UTSW 2 85063034 missense probably damaging 1.00
R5079:Tnks1bp1 UTSW 2 85062626 missense probably damaging 1.00
R5208:Tnks1bp1 UTSW 2 85070632 missense probably damaging 0.96
R5265:Tnks1bp1 UTSW 2 85062754 missense probably benign 0.01
R5512:Tnks1bp1 UTSW 2 85062834 missense probably benign 0.00
R5557:Tnks1bp1 UTSW 2 85063800 missense probably damaging 0.97
R6016:Tnks1bp1 UTSW 2 85052390 missense probably damaging 1.00
R6177:Tnks1bp1 UTSW 2 85059280 start gained probably benign
R6516:Tnks1bp1 UTSW 2 85070727 missense probably damaging 0.97
R6517:Tnks1bp1 UTSW 2 85059345 missense probably benign 0.00
R7032:Tnks1bp1 UTSW 2 85061953 missense probably benign 0.00
R7120:Tnks1bp1 UTSW 2 85072097 missense probably damaging 1.00
R7302:Tnks1bp1 UTSW 2 85052354 missense probably benign 0.24
R7393:Tnks1bp1 UTSW 2 85062866 missense probably benign
R7535:Tnks1bp1 UTSW 2 85063280 nonsense probably null
R7596:Tnks1bp1 UTSW 2 85062713 missense probably benign 0.14
R7680:Tnks1bp1 UTSW 2 85059241 missense probably benign 0.36
Predicted Primers PCR Primer
(F):5'- CTGATGCACAGCAATGGGAATTCG -3'
(R):5'- TGGCCTCACAAAACCTGTCTTCAC -3'

Sequencing Primer
(F):5'- TTCGGGAAGAGGGAGTCC -3'
(R):5'- AGCTCAGAGATCGAATTCCG -3'
Posted On2013-09-03