Incidental Mutation 'R8809:Cfap65'
ID 672248
Institutional Source Beutler Lab
Gene Symbol Cfap65
Ensembl Gene ENSMUSG00000047021
Gene Name cilia and flagella associated protein 65
Synonyms Ccdc108, B230363K08Rik
MMRRC Submission 068645-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.677) question?
Stock # R8809 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 74941230-74974758 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 74942382 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Arginine at position 1724 (K1724R)
Ref Sequence ENSEMBL: ENSMUSP00000092440 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094844]
AlphaFold Q3V0B4
Predicted Effect probably benign
Transcript: ENSMUST00000094844
AA Change: K1724R

PolyPhen 2 Score 0.425 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000092440
Gene: ENSMUSG00000047021
AA Change: K1724R

DomainStartEndE-ValueType
transmembrane domain 111 133 N/A INTRINSIC
low complexity region 212 223 N/A INTRINSIC
internal_repeat_1 745 890 9.31e-5 PROSPERO
internal_repeat_1 1167 1322 9.31e-5 PROSPERO
low complexity region 1350 1361 N/A INTRINSIC
low complexity region 1574 1592 N/A INTRINSIC
coiled coil region 1687 1724 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 97% (63/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene has putative coiled-coil domains and may be a transmembrane protein. The chicken ortholog of this gene is involved in the Rose-comb mutation, which is a large chromosome inversion, resulting in altered comb morphology and defects in sperm motility. [provided by RefSeq, Aug 2016]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr6 C T 10: 89,550,841 (GRCm39) V318I probably benign Het
Adam29 A G 8: 56,325,659 (GRCm39) I265T probably benign Het
Ankdd1a A T 9: 65,415,422 (GRCm39) probably benign Het
Arcn1 T C 9: 44,655,259 (GRCm39) T501A possibly damaging Het
B3gntl1 A T 11: 121,521,690 (GRCm39) F166I possibly damaging Het
Brap T C 5: 121,822,524 (GRCm39) S467P possibly damaging Het
Cenpb A G 2: 131,020,322 (GRCm39) V492A unknown Het
Ces1b C A 8: 93,786,948 (GRCm39) G477V probably damaging Het
Ces1b C T 8: 93,786,949 (GRCm39) G477R probably damaging Het
Chrd A T 16: 20,553,270 (GRCm39) Q182L probably benign Het
Chrnb2 T C 3: 89,664,457 (GRCm39) T486A probably benign Het
Col25a1 A T 3: 130,354,466 (GRCm39) probably null Het
Col4a1 A G 8: 11,295,916 (GRCm39) Y101H unknown Het
Crybg1 T C 10: 43,879,428 (GRCm39) T587A probably damaging Het
Ctnnal1 T A 4: 56,835,374 (GRCm39) N301I possibly damaging Het
Cyp2f2 A T 7: 26,831,995 (GRCm39) N417Y probably damaging Het
Dnah6 T A 6: 73,009,546 (GRCm39) E3800D possibly damaging Het
Dync2i1 A G 12: 116,193,234 (GRCm39) S573P probably damaging Het
Ehmt2 C A 17: 35,127,489 (GRCm39) T906K probably damaging Het
Fbxo15 A G 18: 84,978,200 (GRCm39) H183R possibly damaging Het
Fgl1 T A 8: 41,650,368 (GRCm39) K194* probably null Het
Fxr1 G A 3: 34,108,430 (GRCm39) V314I possibly damaging Het
Hrnr A G 3: 93,239,443 (GRCm39) Q3227R unknown Het
Ier5 G A 1: 154,974,716 (GRCm39) A154V probably benign Het
Igkc T G 6: 70,703,502 (GRCm39) L28V Het
Kcnh1 G A 1: 191,903,722 (GRCm39) G54D probably damaging Het
Kcnn1 C T 8: 71,305,297 (GRCm39) probably null Het
Kifbp C T 10: 62,395,491 (GRCm39) D384N possibly damaging Het
Klra2 T A 6: 131,197,198 (GRCm39) N234I possibly damaging Het
Krtap4-9 T C 11: 99,676,454 (GRCm39) I125T unknown Het
Lrig2 T C 3: 104,368,993 (GRCm39) T897A probably benign Het
Lyve1 G T 7: 110,452,999 (GRCm39) T199K probably damaging Het
Myorg T C 4: 41,498,812 (GRCm39) T273A probably benign Het
Napa A G 7: 15,846,551 (GRCm39) D113G possibly damaging Het
Neurog1 GGTG GGTGTG 13: 56,399,098 (GRCm39) probably null Het
Nf1 T A 11: 79,437,964 (GRCm39) H91Q probably damaging Het
Or4c11c T C 2: 88,662,256 (GRCm39) M265T probably benign Het
Or4n4 A G 14: 50,519,236 (GRCm39) I158T probably benign Het
Or52e3 A T 7: 102,869,446 (GRCm39) N174Y probably benign Het
Or5k16 T A 16: 58,736,248 (GRCm39) Y252F probably damaging Het
Or7g16 A G 9: 18,726,919 (GRCm39) S224P probably damaging Het
Pccb A T 9: 100,867,220 (GRCm39) Y455* probably null Het
Pdk2 A T 11: 94,923,339 (GRCm39) I95N probably damaging Het
Pik3c2g G A 6: 139,714,436 (GRCm39) R196H Het
Pkd1l2 A G 8: 117,726,660 (GRCm39) L2282P probably damaging Het
Plppr2 TCGCC TC 9: 21,855,727 (GRCm39) probably benign Het
Prdm1 A T 10: 44,315,749 (GRCm39) S796T probably benign Het
Rb1 A G 14: 73,503,000 (GRCm39) F424L probably damaging Het
Retreg3 A G 11: 100,992,852 (GRCm39) L190P probably damaging Het
Rffl A G 11: 82,700,864 (GRCm39) Y321H probably damaging Het
Rlbp1 A G 7: 79,025,704 (GRCm39) Y246H probably damaging Het
Rock2 T A 12: 17,015,655 (GRCm39) probably benign Het
Slc17a3 C A 13: 24,039,575 (GRCm39) C244* probably null Het
Snapc1 T C 12: 74,021,812 (GRCm39) S304P probably benign Het
Sp9 T C 2: 73,104,019 (GRCm39) L191P probably damaging Het
Spag17 A T 3: 99,889,738 (GRCm39) E202D probably benign Het
Ss18 A G 18: 14,760,344 (GRCm39) *419R probably null Het
Tacc2 A G 7: 130,276,421 (GRCm39) E1824G possibly damaging Het
Tacc3 T A 5: 33,824,029 (GRCm39) probably benign Het
Tfap2a A T 13: 40,870,829 (GRCm39) L353Q probably damaging Het
Ugt3a1 A G 15: 9,367,345 (GRCm39) I363V possibly damaging Het
Vmn1r158 A G 7: 22,489,775 (GRCm39) C145R probably damaging Het
Vmn1r23 A T 6: 57,903,352 (GRCm39) I142K probably damaging Het
Vmn2r15 A T 5: 109,434,874 (GRCm39) I610N probably benign Het
Yy1 CGGCGACCACGGCGGCGGCGGGGGCG CGGCG 12: 108,759,506 (GRCm39) probably benign Het
Zbtb7c T C 18: 76,270,190 (GRCm39) Y93H probably damaging Het
Zfp62 A G 11: 49,107,238 (GRCm39) N443S probably damaging Het
Other mutations in Cfap65
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01107:Cfap65 APN 1 74,958,342 (GRCm39) critical splice donor site probably null
IGL01526:Cfap65 APN 1 74,950,237 (GRCm39) missense probably damaging 1.00
IGL01716:Cfap65 APN 1 74,966,353 (GRCm39) missense probably benign
IGL01780:Cfap65 APN 1 74,967,507 (GRCm39) nonsense probably null
IGL01993:Cfap65 APN 1 74,959,702 (GRCm39) missense probably damaging 1.00
IGL02164:Cfap65 APN 1 74,967,304 (GRCm39) missense possibly damaging 0.87
IGL02350:Cfap65 APN 1 74,967,507 (GRCm39) nonsense probably null
IGL02357:Cfap65 APN 1 74,967,507 (GRCm39) nonsense probably null
IGL02576:Cfap65 APN 1 74,942,617 (GRCm39) missense probably damaging 1.00
IGL02756:Cfap65 APN 1 74,944,239 (GRCm39) missense probably benign 0.00
IGL02792:Cfap65 APN 1 74,966,337 (GRCm39) missense probably damaging 1.00
IGL02874:Cfap65 APN 1 74,950,267 (GRCm39) nonsense probably null
IGL03101:Cfap65 APN 1 74,967,592 (GRCm39) missense possibly damaging 0.61
IGL03348:Cfap65 APN 1 74,966,778 (GRCm39) missense probably damaging 1.00
IGL03396:Cfap65 APN 1 74,943,801 (GRCm39) missense probably damaging 1.00
PIT4131001:Cfap65 UTSW 1 74,967,501 (GRCm39) missense probably benign 0.05
R0077:Cfap65 UTSW 1 74,971,077 (GRCm39) missense probably damaging 1.00
R0227:Cfap65 UTSW 1 74,971,117 (GRCm39) nonsense probably null
R0281:Cfap65 UTSW 1 74,966,230 (GRCm39) missense probably damaging 1.00
R0312:Cfap65 UTSW 1 74,943,226 (GRCm39) missense probably damaging 1.00
R0331:Cfap65 UTSW 1 74,968,461 (GRCm39) missense probably damaging 1.00
R0331:Cfap65 UTSW 1 74,968,460 (GRCm39) missense probably damaging 1.00
R0347:Cfap65 UTSW 1 74,965,603 (GRCm39) missense probably damaging 1.00
R0359:Cfap65 UTSW 1 74,959,760 (GRCm39) missense probably benign 0.00
R0361:Cfap65 UTSW 1 74,964,599 (GRCm39) missense probably damaging 1.00
R0465:Cfap65 UTSW 1 74,956,043 (GRCm39) missense possibly damaging 0.92
R0549:Cfap65 UTSW 1 74,957,603 (GRCm39) missense probably benign 0.01
R0646:Cfap65 UTSW 1 74,941,328 (GRCm39) missense probably benign 0.09
R0734:Cfap65 UTSW 1 74,958,046 (GRCm39) missense probably damaging 1.00
R0763:Cfap65 UTSW 1 74,943,841 (GRCm39) missense probably damaging 0.99
R0990:Cfap65 UTSW 1 74,960,678 (GRCm39) missense possibly damaging 0.60
R1079:Cfap65 UTSW 1 74,944,872 (GRCm39) missense probably damaging 0.99
R1079:Cfap65 UTSW 1 74,941,606 (GRCm39) missense probably damaging 0.98
R1083:Cfap65 UTSW 1 74,957,663 (GRCm39) splice site probably benign
R1159:Cfap65 UTSW 1 74,968,499 (GRCm39) missense probably damaging 1.00
R1282:Cfap65 UTSW 1 74,964,263 (GRCm39) missense probably benign 0.03
R1644:Cfap65 UTSW 1 74,956,334 (GRCm39) missense probably damaging 1.00
R1796:Cfap65 UTSW 1 74,958,107 (GRCm39) missense probably damaging 1.00
R1950:Cfap65 UTSW 1 74,946,819 (GRCm39) missense probably damaging 1.00
R2079:Cfap65 UTSW 1 74,956,358 (GRCm39) missense probably benign 0.30
R2132:Cfap65 UTSW 1 74,946,850 (GRCm39) missense probably damaging 1.00
R2136:Cfap65 UTSW 1 74,956,432 (GRCm39) frame shift probably null
R2219:Cfap65 UTSW 1 74,943,184 (GRCm39) missense probably damaging 1.00
R2220:Cfap65 UTSW 1 74,943,184 (GRCm39) missense probably damaging 1.00
R2291:Cfap65 UTSW 1 74,965,634 (GRCm39) missense probably damaging 1.00
R2417:Cfap65 UTSW 1 74,966,345 (GRCm39) small insertion probably benign
R3114:Cfap65 UTSW 1 74,966,291 (GRCm39) missense probably damaging 1.00
R4202:Cfap65 UTSW 1 74,959,701 (GRCm39) missense probably damaging 1.00
R4214:Cfap65 UTSW 1 74,966,840 (GRCm39) missense possibly damaging 0.93
R4254:Cfap65 UTSW 1 74,942,517 (GRCm39) missense probably benign 0.17
R4547:Cfap65 UTSW 1 74,946,771 (GRCm39) missense probably damaging 1.00
R4548:Cfap65 UTSW 1 74,946,771 (GRCm39) missense probably damaging 1.00
R4588:Cfap65 UTSW 1 74,943,215 (GRCm39) missense possibly damaging 0.92
R4657:Cfap65 UTSW 1 74,964,513 (GRCm39) intron probably benign
R4701:Cfap65 UTSW 1 74,958,067 (GRCm39) missense probably damaging 0.96
R4755:Cfap65 UTSW 1 74,967,520 (GRCm39) missense probably damaging 1.00
R4820:Cfap65 UTSW 1 74,966,791 (GRCm39) missense probably benign 0.06
R4831:Cfap65 UTSW 1 74,956,454 (GRCm39) missense possibly damaging 0.93
R4866:Cfap65 UTSW 1 74,964,716 (GRCm39) missense probably damaging 1.00
R4869:Cfap65 UTSW 1 74,958,420 (GRCm39) missense probably benign 0.00
R4881:Cfap65 UTSW 1 74,946,772 (GRCm39) missense probably damaging 1.00
R4884:Cfap65 UTSW 1 74,942,283 (GRCm39) missense possibly damaging 0.47
R4950:Cfap65 UTSW 1 74,945,495 (GRCm39) nonsense probably null
R5074:Cfap65 UTSW 1 74,962,137 (GRCm39) missense probably benign 0.04
R5083:Cfap65 UTSW 1 74,945,600 (GRCm39) missense probably damaging 1.00
R5164:Cfap65 UTSW 1 74,965,675 (GRCm39) missense probably damaging 1.00
R5268:Cfap65 UTSW 1 74,964,061 (GRCm39) missense probably benign 0.07
R5333:Cfap65 UTSW 1 74,942,334 (GRCm39) missense probably benign 0.03
R5417:Cfap65 UTSW 1 74,964,259 (GRCm39) missense probably damaging 1.00
R5582:Cfap65 UTSW 1 74,946,677 (GRCm39) intron probably benign
R5669:Cfap65 UTSW 1 74,964,127 (GRCm39) missense probably damaging 0.99
R6010:Cfap65 UTSW 1 74,962,190 (GRCm39) missense probably damaging 1.00
R6084:Cfap65 UTSW 1 74,959,564 (GRCm39) missense probably damaging 1.00
R6112:Cfap65 UTSW 1 74,942,298 (GRCm39) missense probably benign 0.14
R6425:Cfap65 UTSW 1 74,966,868 (GRCm39) missense probably benign 0.00
R6677:Cfap65 UTSW 1 74,943,844 (GRCm39) missense probably damaging 1.00
R6693:Cfap65 UTSW 1 74,956,445 (GRCm39) missense probably benign 0.00
R6838:Cfap65 UTSW 1 74,971,180 (GRCm39) missense probably benign 0.06
R6861:Cfap65 UTSW 1 74,964,274 (GRCm39) missense probably damaging 1.00
R6958:Cfap65 UTSW 1 74,971,058 (GRCm39) missense possibly damaging 0.58
R7134:Cfap65 UTSW 1 74,965,792 (GRCm39) missense probably benign 0.01
R7320:Cfap65 UTSW 1 74,965,763 (GRCm39) missense probably damaging 0.99
R7340:Cfap65 UTSW 1 74,960,742 (GRCm39) missense probably benign 0.07
R7426:Cfap65 UTSW 1 74,959,585 (GRCm39) missense possibly damaging 0.92
R7529:Cfap65 UTSW 1 74,965,769 (GRCm39) missense probably damaging 1.00
R7634:Cfap65 UTSW 1 74,941,593 (GRCm39) missense probably damaging 1.00
R7654:Cfap65 UTSW 1 74,972,303 (GRCm39) missense probably benign 0.44
R7704:Cfap65 UTSW 1 74,967,527 (GRCm39) missense probably benign 0.19
R7727:Cfap65 UTSW 1 74,965,784 (GRCm39) missense probably benign 0.00
R7895:Cfap65 UTSW 1 74,972,321 (GRCm39) missense probably benign 0.05
R8215:Cfap65 UTSW 1 74,949,902 (GRCm39) missense probably damaging 1.00
R8344:Cfap65 UTSW 1 74,967,203 (GRCm39) missense probably benign 0.01
R8345:Cfap65 UTSW 1 74,967,203 (GRCm39) missense probably benign 0.01
R8413:Cfap65 UTSW 1 74,956,328 (GRCm39) nonsense probably null
R8431:Cfap65 UTSW 1 74,967,203 (GRCm39) missense probably benign 0.01
R8432:Cfap65 UTSW 1 74,967,203 (GRCm39) missense probably benign 0.01
R8528:Cfap65 UTSW 1 74,945,096 (GRCm39) missense possibly damaging 0.88
R8996:Cfap65 UTSW 1 74,941,347 (GRCm39) missense probably benign 0.11
R9020:Cfap65 UTSW 1 74,959,552 (GRCm39) missense probably damaging 1.00
R9043:Cfap65 UTSW 1 74,943,847 (GRCm39) missense possibly damaging 0.88
R9127:Cfap65 UTSW 1 74,958,510 (GRCm39) splice site probably benign
R9187:Cfap65 UTSW 1 74,956,517 (GRCm39) missense probably benign 0.00
R9210:Cfap65 UTSW 1 74,959,567 (GRCm39) missense probably benign
R9212:Cfap65 UTSW 1 74,959,567 (GRCm39) missense probably benign
R9273:Cfap65 UTSW 1 74,960,769 (GRCm39) missense probably benign 0.00
R9454:Cfap65 UTSW 1 74,944,210 (GRCm39) missense probably damaging 1.00
R9514:Cfap65 UTSW 1 74,945,468 (GRCm39) critical splice donor site probably null
R9595:Cfap65 UTSW 1 74,946,537 (GRCm39) missense probably damaging 1.00
R9721:Cfap65 UTSW 1 74,958,501 (GRCm39) missense probably benign 0.16
R9742:Cfap65 UTSW 1 74,943,840 (GRCm39) missense probably benign 0.08
RF009:Cfap65 UTSW 1 74,944,806 (GRCm39) missense probably damaging 1.00
Z1176:Cfap65 UTSW 1 74,949,906 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCCTCAGTGTCAGCTTCTC -3'
(R):5'- TAGCCCAGAAAAGCAGCTTGTAC -3'

Sequencing Primer
(F):5'- AGTGTCAGCTTCTCCCGAG -3'
(R):5'- AAAGCAGCTTGTACTTAGTGCCG -3'
Posted On 2021-04-30