Incidental Mutation 'R8809:Cfap65'
ID672248
Institutional Source Beutler Lab
Gene Symbol Cfap65
Ensembl Gene ENSMUSG00000047021
Gene Namecilia and flagella associated protein 65
SynonymsCcdc108, B230363K08Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.267) question?
Stock #R8809 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location74902071-74935599 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 74903223 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 1724 (K1724R)
Ref Sequence ENSEMBL: ENSMUSP00000092440 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094844]
Predicted Effect probably benign
Transcript: ENSMUST00000094844
AA Change: K1724R

PolyPhen 2 Score 0.425 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000092440
Gene: ENSMUSG00000047021
AA Change: K1724R

DomainStartEndE-ValueType
transmembrane domain 111 133 N/A INTRINSIC
low complexity region 212 223 N/A INTRINSIC
internal_repeat_1 745 890 9.31e-5 PROSPERO
internal_repeat_1 1167 1322 9.31e-5 PROSPERO
low complexity region 1350 1361 N/A INTRINSIC
low complexity region 1574 1592 N/A INTRINSIC
coiled coil region 1687 1724 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene has putative coiled-coil domains and may be a transmembrane protein. The chicken ortholog of this gene is involved in the Rose-comb mutation, which is a large chromosome inversion, resulting in altered comb morphology and defects in sperm motility. [provided by RefSeq, Aug 2016]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr6 C T 10: 89,714,979 V318I probably benign Het
Adam29 A G 8: 55,872,624 I265T probably benign Het
AI464131 T C 4: 41,498,812 T273A probably benign Het
Arcn1 T C 9: 44,743,962 T501A possibly damaging Het
B3gntl1 A T 11: 121,630,864 F166I possibly damaging Het
Brap T C 5: 121,684,461 S467P possibly damaging Het
Cenpb A G 2: 131,178,402 V492A unknown Het
Ces1b C A 8: 93,060,320 G477V probably damaging Het
Ces1b C T 8: 93,060,321 G477R probably damaging Het
Chrd A T 16: 20,734,520 Q182L probably benign Het
Chrnb2 T C 3: 89,757,150 T486A probably benign Het
Col25a1 A T 3: 130,560,817 probably null Het
Col4a1 A G 8: 11,245,916 Y101H unknown Het
Crybg1 T C 10: 44,003,432 T587A probably damaging Het
Ctnnal1 T A 4: 56,835,374 N301I possibly damaging Het
Cyp2f2 A T 7: 27,132,570 N417Y probably damaging Het
Dnah6 T A 6: 73,032,563 E3800D possibly damaging Het
Ehmt2 C A 17: 34,908,513 T906K probably damaging Het
Fbxo15 A G 18: 84,960,075 H183R possibly damaging Het
Fgl1 T A 8: 41,197,331 K194* probably null Het
Fxr1 G A 3: 34,054,281 V314I possibly damaging Het
Hrnr A G 3: 93,332,136 Q3227R unknown Het
Ier5 G A 1: 155,098,970 A154V probably benign Het
Igkc T G 6: 70,726,518 L28V Het
Kcnh1 G A 1: 192,221,414 G54D probably damaging Het
Kcnn1 C T 8: 70,852,653 probably null Het
Kif1bp C T 10: 62,559,712 D384N possibly damaging Het
Klra2 T A 6: 131,220,235 N234I possibly damaging Het
Krtap4-9 T C 11: 99,785,628 I125T unknown Het
Lrig2 T C 3: 104,461,677 T897A probably benign Het
Lyve1 G T 7: 110,853,792 T199K probably damaging Het
Napa A G 7: 16,112,626 D113G possibly damaging Het
Neurog1 GGTG GGTGTG 13: 56,251,285 probably null Het
Nf1 T A 11: 79,547,138 H91Q probably damaging Het
Olfr1205 T C 2: 88,831,912 M265T probably benign Het
Olfr180 T A 16: 58,915,885 Y252F probably damaging Het
Olfr594 A T 7: 103,220,239 N174Y probably benign Het
Olfr732 A G 14: 50,281,779 I158T probably benign Het
Olfr828 A G 9: 18,815,623 S224P probably damaging Het
Pccb A T 9: 100,985,167 Y455* probably null Het
Pdk2 A T 11: 95,032,513 I95N probably damaging Het
Pik3c2g G A 6: 139,768,710 R196H Het
Pkd1l2 A G 8: 116,999,921 L2282P probably damaging Het
Plppr2 TCGCC TC 9: 21,944,431 probably benign Het
Prdm1 A T 10: 44,439,753 S796T probably benign Het
Rb1 A G 14: 73,265,560 F424L probably damaging Het
Retreg3 A G 11: 101,102,026 L190P probably damaging Het
Rffl A G 11: 82,810,038 Y321H probably damaging Het
Rlbp1 A G 7: 79,375,956 Y246H probably damaging Het
Rock2 T A 12: 16,965,654 probably benign Het
Slc17a3 C A 13: 23,855,592 C244* probably null Het
Snapc1 T C 12: 73,975,038 S304P probably benign Het
Sp9 T C 2: 73,273,675 L191P probably damaging Het
Spag17 A T 3: 99,982,422 E202D probably benign Het
Ss18 A G 18: 14,627,287 *419R probably null Het
Tacc2 A G 7: 130,674,691 E1824G possibly damaging Het
Tfap2a A T 13: 40,717,353 L353Q probably damaging Het
Ugt3a2 A G 15: 9,367,259 I363V possibly damaging Het
Vmn1r158 A G 7: 22,790,350 C145R probably damaging Het
Vmn1r23 A T 6: 57,926,367 I142K probably damaging Het
Vmn2r15 A T 5: 109,287,008 I610N probably benign Het
Wdr60 A G 12: 116,229,614 S573P probably damaging Het
Yy1 CGGCGACCACGGCGGCGGCGGGGGCG CGGCG 12: 108,793,580 probably benign Het
Zbtb7c T C 18: 76,137,119 Y93H probably damaging Het
Zfp62 A G 11: 49,216,411 N443S probably damaging Het
Other mutations in Cfap65
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01107:Cfap65 APN 1 74919183 critical splice donor site probably null
IGL01526:Cfap65 APN 1 74911078 missense probably damaging 1.00
IGL01716:Cfap65 APN 1 74927194 missense probably benign
IGL01780:Cfap65 APN 1 74928348 nonsense probably null
IGL01993:Cfap65 APN 1 74920543 missense probably damaging 1.00
IGL02164:Cfap65 APN 1 74928145 missense possibly damaging 0.87
IGL02350:Cfap65 APN 1 74928348 nonsense probably null
IGL02357:Cfap65 APN 1 74928348 nonsense probably null
IGL02576:Cfap65 APN 1 74903458 missense probably damaging 1.00
IGL02756:Cfap65 APN 1 74905080 missense probably benign 0.00
IGL02792:Cfap65 APN 1 74927178 missense probably damaging 1.00
IGL02874:Cfap65 APN 1 74911108 nonsense probably null
IGL03101:Cfap65 APN 1 74928433 missense possibly damaging 0.61
IGL03348:Cfap65 APN 1 74927619 missense probably damaging 1.00
IGL03396:Cfap65 APN 1 74904642 missense probably damaging 1.00
PIT4131001:Cfap65 UTSW 1 74928342 missense probably benign 0.05
R0077:Cfap65 UTSW 1 74931918 missense probably damaging 1.00
R0227:Cfap65 UTSW 1 74931958 nonsense probably null
R0281:Cfap65 UTSW 1 74927071 missense probably damaging 1.00
R0312:Cfap65 UTSW 1 74904067 missense probably damaging 1.00
R0331:Cfap65 UTSW 1 74929301 missense probably damaging 1.00
R0331:Cfap65 UTSW 1 74929302 missense probably damaging 1.00
R0347:Cfap65 UTSW 1 74926444 missense probably damaging 1.00
R0359:Cfap65 UTSW 1 74920601 missense probably benign 0.00
R0361:Cfap65 UTSW 1 74925440 missense probably damaging 1.00
R0465:Cfap65 UTSW 1 74916884 missense possibly damaging 0.92
R0549:Cfap65 UTSW 1 74918444 missense probably benign 0.01
R0646:Cfap65 UTSW 1 74902169 missense probably benign 0.09
R0734:Cfap65 UTSW 1 74918887 missense probably damaging 1.00
R0763:Cfap65 UTSW 1 74904682 missense probably damaging 0.99
R0990:Cfap65 UTSW 1 74921519 missense possibly damaging 0.60
R1079:Cfap65 UTSW 1 74902447 missense probably damaging 0.98
R1079:Cfap65 UTSW 1 74905713 missense probably damaging 0.99
R1083:Cfap65 UTSW 1 74918504 splice site probably benign
R1159:Cfap65 UTSW 1 74929340 missense probably damaging 1.00
R1282:Cfap65 UTSW 1 74925104 missense probably benign 0.03
R1644:Cfap65 UTSW 1 74917175 missense probably damaging 1.00
R1796:Cfap65 UTSW 1 74918948 missense probably damaging 1.00
R1950:Cfap65 UTSW 1 74907660 missense probably damaging 1.00
R2079:Cfap65 UTSW 1 74917199 missense probably benign 0.30
R2132:Cfap65 UTSW 1 74907691 missense probably damaging 1.00
R2136:Cfap65 UTSW 1 74917273 frame shift probably null
R2219:Cfap65 UTSW 1 74904025 missense probably damaging 1.00
R2220:Cfap65 UTSW 1 74904025 missense probably damaging 1.00
R2291:Cfap65 UTSW 1 74926475 missense probably damaging 1.00
R2417:Cfap65 UTSW 1 74927186 small insertion probably benign
R3114:Cfap65 UTSW 1 74927132 missense probably damaging 1.00
R4202:Cfap65 UTSW 1 74920542 missense probably damaging 1.00
R4214:Cfap65 UTSW 1 74927681 missense possibly damaging 0.93
R4254:Cfap65 UTSW 1 74903358 missense probably benign 0.17
R4547:Cfap65 UTSW 1 74907612 missense probably damaging 1.00
R4548:Cfap65 UTSW 1 74907612 missense probably damaging 1.00
R4588:Cfap65 UTSW 1 74904056 missense possibly damaging 0.92
R4657:Cfap65 UTSW 1 74925354 intron probably benign
R4701:Cfap65 UTSW 1 74918908 missense probably damaging 0.96
R4755:Cfap65 UTSW 1 74928361 missense probably damaging 1.00
R4820:Cfap65 UTSW 1 74927632 missense probably benign 0.06
R4831:Cfap65 UTSW 1 74917295 missense possibly damaging 0.93
R4866:Cfap65 UTSW 1 74925557 missense probably damaging 1.00
R4869:Cfap65 UTSW 1 74919261 missense probably benign 0.00
R4881:Cfap65 UTSW 1 74907613 missense probably damaging 1.00
R4884:Cfap65 UTSW 1 74903124 missense possibly damaging 0.47
R4950:Cfap65 UTSW 1 74906336 nonsense probably null
R5074:Cfap65 UTSW 1 74922978 missense probably benign 0.04
R5083:Cfap65 UTSW 1 74906441 missense probably damaging 1.00
R5164:Cfap65 UTSW 1 74926516 missense probably damaging 1.00
R5268:Cfap65 UTSW 1 74924902 missense probably benign 0.07
R5333:Cfap65 UTSW 1 74903175 missense probably benign 0.03
R5417:Cfap65 UTSW 1 74925100 missense probably damaging 1.00
R5582:Cfap65 UTSW 1 74907518 intron probably benign
R5669:Cfap65 UTSW 1 74924968 missense probably damaging 0.99
R6010:Cfap65 UTSW 1 74923031 missense probably damaging 1.00
R6084:Cfap65 UTSW 1 74920405 missense probably damaging 1.00
R6112:Cfap65 UTSW 1 74903139 missense probably benign 0.14
R6425:Cfap65 UTSW 1 74927709 missense probably benign 0.00
R6677:Cfap65 UTSW 1 74904685 missense probably damaging 1.00
R6693:Cfap65 UTSW 1 74917286 missense probably benign 0.00
R6838:Cfap65 UTSW 1 74932021 missense probably benign 0.06
R6861:Cfap65 UTSW 1 74925115 missense probably damaging 1.00
R6958:Cfap65 UTSW 1 74931899 missense possibly damaging 0.58
R7134:Cfap65 UTSW 1 74926633 missense probably benign 0.01
R7320:Cfap65 UTSW 1 74926604 missense probably damaging 0.99
R7340:Cfap65 UTSW 1 74921583 missense probably benign 0.07
R7426:Cfap65 UTSW 1 74920426 missense possibly damaging 0.92
R7529:Cfap65 UTSW 1 74926610 missense probably damaging 1.00
R7634:Cfap65 UTSW 1 74902434 missense probably damaging 1.00
R7654:Cfap65 UTSW 1 74933144 missense probably benign 0.44
R7704:Cfap65 UTSW 1 74928368 missense probably benign 0.19
R7727:Cfap65 UTSW 1 74926625 missense probably benign 0.00
R7895:Cfap65 UTSW 1 74933162 missense probably benign 0.05
R8344:Cfap65 UTSW 1 74928044 missense probably benign 0.01
R8345:Cfap65 UTSW 1 74928044 missense probably benign 0.01
R8413:Cfap65 UTSW 1 74917169 nonsense probably null
R8431:Cfap65 UTSW 1 74928044 missense probably benign 0.01
R8432:Cfap65 UTSW 1 74928044 missense probably benign 0.01
R8528:Cfap65 UTSW 1 74905937 missense possibly damaging 0.88
RF009:Cfap65 UTSW 1 74905647 missense probably damaging 1.00
Z1176:Cfap65 UTSW 1 74910747 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCCTCAGTGTCAGCTTCTC -3'
(R):5'- TAGCCCAGAAAAGCAGCTTGTAC -3'

Sequencing Primer
(F):5'- AGTGTCAGCTTCTCCCGAG -3'
(R):5'- AAAGCAGCTTGTACTTAGTGCCG -3'
Posted On2021-04-30