Incidental Mutation 'K3955:Olfr272'
ID67225
Institutional Source Beutler Lab
Gene Symbol Olfr272
Ensembl Gene ENSMUSG00000051593
Gene Nameolfactory receptor 272
SynonymsGA_x6K02T2N78B-7084885-7085844, MOR262-7
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock #K3955 (G3) of strain 706
Quality Score225
Status Validated
Chromosome4
Chromosomal Location52910207-52919178 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 52911081 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 238 (F238L)
Ref Sequence ENSEMBL: ENSMUSP00000149339 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051600] [ENSMUST00000107667] [ENSMUST00000213989]
Predicted Effect probably damaging
Transcript: ENSMUST00000051600
AA Change: F238L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000055721
Gene: ENSMUSG00000051593
AA Change: F238L

DomainStartEndE-ValueType
Pfam:7tm_4 31 314 1.6e-54 PFAM
Pfam:7tm_1 41 296 9.5e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000107667
AA Change: F238L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000103294
Gene: ENSMUSG00000051593
AA Change: F238L

DomainStartEndE-ValueType
Pfam:7tm_1 39 294 9.5e-33 PFAM
Pfam:7tm_4 138 287 3.3e-42 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213989
AA Change: F238L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217085
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.9%
  • 10x: 97.4%
  • 20x: 94.9%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agap1 G A 1: 89,887,604 R738H probably damaging Het
Arhgap28 T C 17: 68,004,006 E2G probably damaging Het
Atad2b C A 12: 4,954,536 probably benign Het
Atmin T A 8: 116,957,036 C478* probably null Het
Calr T C 8: 84,846,273 Y57C probably damaging Het
Cdh13 G A 8: 118,675,104 V82M probably damaging Het
Ces3a A T 8: 105,050,627 probably benign Het
Dmbt1 T C 7: 131,119,564 Y1854H probably damaging Het
Dnah1 T A 14: 31,266,459 M3429L probably benign Het
Dscam A G 16: 96,673,687 F1225S probably benign Het
E030025P04Rik G A 11: 109,143,952 P37S unknown Het
Eral1 A T 11: 78,076,021 D189E probably damaging Het
Fbxw14 G T 9: 109,276,245 P284Q possibly damaging Het
Fcrl6 A G 1: 172,597,684 V260A probably benign Het
Fezf2 A T 14: 12,345,097 F30Y probably damaging Het
Gjb4 A T 4: 127,351,500 V216D probably benign Het
Gm13023 T C 4: 143,795,140 I442T possibly damaging Het
Gm9758 G A 5: 14,913,508 probably benign Het
Gm9758 C G 5: 14,913,539 V92L probably benign Het
Gmps A C 3: 64,001,533 R485S probably damaging Het
Gtdc1 C T 2: 44,752,221 probably null Het
H2-Ob C T 17: 34,241,184 R19C probably damaging Het
Lars2 T C 9: 123,377,777 V103A probably damaging Het
Ndnf G A 6: 65,701,429 probably benign Het
Nectin1 A G 9: 43,792,078 Y211C probably damaging Het
Notch4 C T 17: 34,568,462 T332I probably damaging Het
Olfr945 A C 9: 39,258,630 L14W probably damaging Het
Olfr968 A G 9: 39,772,173 I209T probably benign Het
Paf1 T C 7: 28,396,925 probably null Het
Pcdhb1 G T 18: 37,265,973 G326C probably damaging Het
Plcl1 A G 1: 55,697,939 Y813C possibly damaging Het
Prkcq T C 2: 11,246,793 probably benign Het
Proser3 G T 7: 30,543,499 P218T probably damaging Het
Rccd1 G A 7: 80,320,671 S66F probably benign Het
Recql G T 6: 142,378,206 S54* probably null Het
Samd15 G T 12: 87,200,760 G73V probably benign Het
Siglec1 T C 2: 131,081,439 N462S probably benign Het
Skiv2l2 A C 13: 112,910,979 Y277* probably null Het
Syne2 G T 12: 75,930,665 A1296S probably damaging Het
Tlk1 T C 2: 70,721,701 E542G possibly damaging Het
Tnks1bp1 C T 2: 85,062,411 T232I probably benign Het
Tnrc6c T A 11: 117,760,738 Y1696N probably damaging Het
Uggt1 A G 1: 36,162,353 I1102T probably benign Het
Vmn1r84 C T 7: 12,361,957 V270M probably damaging Het
Wasf1 C T 10: 40,936,195 P327S unknown Het
Other mutations in Olfr272
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Olfr272 APN 4 52911618 missense possibly damaging 0.95
IGL02224:Olfr272 APN 4 52911392 missense probably damaging 0.97
IGL03293:Olfr272 APN 4 52910835 makesense probably null
R0195:Olfr272 UTSW 4 52910849 missense probably benign 0.00
R0197:Olfr272 UTSW 4 52910849 missense probably benign 0.00
R0445:Olfr272 UTSW 4 52910849 missense probably benign 0.00
R1517:Olfr272 UTSW 4 52911502 nonsense probably null
R1536:Olfr272 UTSW 4 52911260 missense probably benign 0.43
R1540:Olfr272 UTSW 4 52910996 missense probably benign 0.00
R1551:Olfr272 UTSW 4 52911397 nonsense probably null
R1612:Olfr272 UTSW 4 52911501 missense probably benign
R1920:Olfr272 UTSW 4 52910849 missense probably benign
R2181:Olfr272 UTSW 4 52911524 missense probably damaging 1.00
R5410:Olfr272 UTSW 4 52910991 missense probably benign 0.01
R6331:Olfr272 UTSW 4 52911399 missense probably damaging 1.00
R6336:Olfr272 UTSW 4 52911459 missense probably damaging 1.00
R7085:Olfr272 UTSW 4 52910961 missense probably benign 0.02
R7541:Olfr272 UTSW 4 52911376 missense probably benign 0.04
R7727:Olfr272 UTSW 4 52911368 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- TGTTCTGAACAGCAGCCTTCACATC -3'
(R):5'- AGACCTCTCTTGCAGTGCAATTACC -3'

Sequencing Primer
(F):5'- TCCTCAGACTGTAGATAAGAGGATTG -3'
(R):5'- TGCAGTGCAATTACCATTCTG -3'
Posted On2013-09-03