Incidental Mutation 'R8809:Chrnb2'
ID672255
Institutional Source Beutler Lab
Gene Symbol Chrnb2
Ensembl Gene ENSMUSG00000027950
Gene Namecholinergic receptor, nicotinic, beta polypeptide 2 (neuronal)
SynonymsC030030P04Rik, Acrb2, Acrb-2, [b]2-nAchR
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.328) question?
Stock #R8809 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location89746195-89764632 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 89757150 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 486 (T486A)
Ref Sequence ENSEMBL: ENSMUSP00000029562 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029562] [ENSMUST00000098924] [ENSMUST00000107405] [ENSMUST00000200558]
Predicted Effect probably benign
Transcript: ENSMUST00000029562
AA Change: T486A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000029562
Gene: ENSMUSG00000027950
AA Change: T486A

DomainStartEndE-ValueType
Pfam:Neur_chan_LBD 29 234 5.6e-75 PFAM
Pfam:Neur_chan_memb 241 477 1.7e-86 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000098924
SMART Domains Protein: ENSMUSP00000096525
Gene: ENSMUSG00000027951

DomainStartEndE-ValueType
Zalpha 1 64 3.1e-24 SMART
low complexity region 74 89 N/A INTRINSIC
low complexity region 99 111 N/A INTRINSIC
DSRM 209 275 3.6e-21 SMART
DSRM 320 386 4.36e-20 SMART
DSRM 428 494 1.58e-17 SMART
low complexity region 515 526 N/A INTRINSIC
ADEAMc 540 923 3.74e-205 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107405
SMART Domains Protein: ENSMUSP00000103028
Gene: ENSMUSG00000027951

DomainStartEndE-ValueType
Zalpha 134 203 8.97e-30 SMART
Zalpha 244 312 7.69e-29 SMART
low complexity region 322 337 N/A INTRINSIC
low complexity region 347 359 N/A INTRINSIC
DSRM 457 523 3.6e-21 SMART
DSRM 568 634 4.36e-20 SMART
DSRM 676 742 1.58e-17 SMART
low complexity region 763 774 N/A INTRINSIC
ADEAMc 788 1171 3.74e-205 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000200558
SMART Domains Protein: ENSMUSP00000143441
Gene: ENSMUSG00000027950

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Neur_chan_LBD 29 234 1.5e-71 PFAM
Pfam:Neur_chan_memb 241 454 4.8e-61 PFAM
low complexity region 657 666 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Neuronal acetylcholine receptors are homo- or heteropentameric complexes composed of homologous alpha and beta subunits. They belong to a superfamily of ligand-gated ion channels which allow the flow of sodium and potassium across the plasma membrane in response to ligands such as acetylcholine and nicotine. This gene encodes one of several beta subunits. Mutations in this gene are associated with autosomal dominant nocturnal frontal lobe epilepsy. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations have impaired responses to nicotine, but show improved passive avoidance behavior. With age, mutants show more neurodegeneration and alterations of the visual system, with decreased cortical visual acuity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr6 C T 10: 89,714,979 V318I probably benign Het
Adam29 A G 8: 55,872,624 I265T probably benign Het
AI464131 T C 4: 41,498,812 T273A probably benign Het
Arcn1 T C 9: 44,743,962 T501A possibly damaging Het
B3gntl1 A T 11: 121,630,864 F166I possibly damaging Het
Brap T C 5: 121,684,461 S467P possibly damaging Het
Cenpb A G 2: 131,178,402 V492A unknown Het
Ces1b C A 8: 93,060,320 G477V probably damaging Het
Ces1b C T 8: 93,060,321 G477R probably damaging Het
Cfap65 T C 1: 74,903,223 K1724R probably benign Het
Chrd A T 16: 20,734,520 Q182L probably benign Het
Col25a1 A T 3: 130,560,817 probably null Het
Col4a1 A G 8: 11,245,916 Y101H unknown Het
Crybg1 T C 10: 44,003,432 T587A probably damaging Het
Ctnnal1 T A 4: 56,835,374 N301I possibly damaging Het
Cyp2f2 A T 7: 27,132,570 N417Y probably damaging Het
Dnah6 T A 6: 73,032,563 E3800D possibly damaging Het
Ehmt2 C A 17: 34,908,513 T906K probably damaging Het
Fbxo15 A G 18: 84,960,075 H183R possibly damaging Het
Fgl1 T A 8: 41,197,331 K194* probably null Het
Fxr1 G A 3: 34,054,281 V314I possibly damaging Het
Hrnr A G 3: 93,332,136 Q3227R unknown Het
Ier5 G A 1: 155,098,970 A154V probably benign Het
Igkc T G 6: 70,726,518 L28V Het
Kcnh1 G A 1: 192,221,414 G54D probably damaging Het
Kcnn1 C T 8: 70,852,653 probably null Het
Kif1bp C T 10: 62,559,712 D384N possibly damaging Het
Klra2 T A 6: 131,220,235 N234I possibly damaging Het
Krtap4-9 T C 11: 99,785,628 I125T unknown Het
Lrig2 T C 3: 104,461,677 T897A probably benign Het
Lyve1 G T 7: 110,853,792 T199K probably damaging Het
Napa A G 7: 16,112,626 D113G possibly damaging Het
Neurog1 GGTG GGTGTG 13: 56,251,285 probably null Het
Nf1 T A 11: 79,547,138 H91Q probably damaging Het
Olfr1205 T C 2: 88,831,912 M265T probably benign Het
Olfr180 T A 16: 58,915,885 Y252F probably damaging Het
Olfr594 A T 7: 103,220,239 N174Y probably benign Het
Olfr732 A G 14: 50,281,779 I158T probably benign Het
Olfr828 A G 9: 18,815,623 S224P probably damaging Het
Pccb A T 9: 100,985,167 Y455* probably null Het
Pdk2 A T 11: 95,032,513 I95N probably damaging Het
Pik3c2g G A 6: 139,768,710 R196H Het
Pkd1l2 A G 8: 116,999,921 L2282P probably damaging Het
Plppr2 TCGCC TC 9: 21,944,431 probably benign Het
Prdm1 A T 10: 44,439,753 S796T probably benign Het
Rb1 A G 14: 73,265,560 F424L probably damaging Het
Retreg3 A G 11: 101,102,026 L190P probably damaging Het
Rffl A G 11: 82,810,038 Y321H probably damaging Het
Rlbp1 A G 7: 79,375,956 Y246H probably damaging Het
Rock2 T A 12: 16,965,654 probably benign Het
Slc17a3 C A 13: 23,855,592 C244* probably null Het
Snapc1 T C 12: 73,975,038 S304P probably benign Het
Sp9 T C 2: 73,273,675 L191P probably damaging Het
Spag17 A T 3: 99,982,422 E202D probably benign Het
Ss18 A G 18: 14,627,287 *419R probably null Het
Tacc2 A G 7: 130,674,691 E1824G possibly damaging Het
Tfap2a A T 13: 40,717,353 L353Q probably damaging Het
Ugt3a2 A G 15: 9,367,259 I363V possibly damaging Het
Vmn1r158 A G 7: 22,790,350 C145R probably damaging Het
Vmn1r23 A T 6: 57,926,367 I142K probably damaging Het
Vmn2r15 A T 5: 109,287,008 I610N probably benign Het
Wdr60 A G 12: 116,229,614 S573P probably damaging Het
Yy1 CGGCGACCACGGCGGCGGCGGGGGCG CGGCG 12: 108,793,580 probably benign Het
Zbtb7c T C 18: 76,137,119 Y93H probably damaging Het
Zfp62 A G 11: 49,216,411 N443S probably damaging Het
Other mutations in Chrnb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03108:Chrnb2 APN 3 89763374 splice site probably benign
IGL03117:Chrnb2 APN 3 89763245 missense probably damaging 1.00
IGL03391:Chrnb2 APN 3 89760877 missense probably damaging 0.98
R0131:Chrnb2 UTSW 3 89764406 start codon destroyed probably null 0.01
R0131:Chrnb2 UTSW 3 89764406 start codon destroyed probably null 0.01
R0132:Chrnb2 UTSW 3 89764406 start codon destroyed probably null 0.01
R1726:Chrnb2 UTSW 3 89761202 missense probably damaging 1.00
R2095:Chrnb2 UTSW 3 89761437 missense probably benign 0.01
R2124:Chrnb2 UTSW 3 89769341 unclassified probably benign
R3548:Chrnb2 UTSW 3 89761591 missense probably benign 0.04
R4212:Chrnb2 UTSW 3 89761544 missense probably damaging 1.00
R4902:Chrnb2 UTSW 3 89760941 missense probably damaging 1.00
R6307:Chrnb2 UTSW 3 89761524 missense probably damaging 1.00
R6751:Chrnb2 UTSW 3 89761576 missense probably damaging 1.00
R6999:Chrnb2 UTSW 3 89761315 missense possibly damaging 0.71
R7318:Chrnb2 UTSW 3 89763367 critical splice acceptor site probably null
R7826:Chrnb2 UTSW 3 89763243 missense probably damaging 1.00
R8025:Chrnb2 UTSW 3 89761342 missense probably damaging 1.00
R8094:Chrnb2 UTSW 3 89761391 missense probably damaging 1.00
R8143:Chrnb2 UTSW 3 89747323 missense unknown
R8739:Chrnb2 UTSW 3 89762439 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAACATGAGGCAGCTGGTC -3'
(R):5'- ACGTGGTAGGGACTTTCCTG -3'

Sequencing Primer
(F):5'- CTGGTCCAGCCTCCAGG -3'
(R):5'- GCCTCTTCCCACACCAGG -3'
Posted On2021-04-30