Incidental Mutation 'R8809:Hrnr'
ID672256
Institutional Source Beutler Lab
Gene Symbol Hrnr
Ensembl Gene ENSMUSG00000041991
Gene Namehornerin
Synonyms1110033K19Rik, S100a18, A530063N20Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8809 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location93319749-93333570 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 93332136 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 3227 (Q3227R)
Ref Sequence ENSEMBL: ENSMUSP00000091288 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090856] [ENSMUST00000093774]
Predicted Effect unknown
Transcript: ENSMUST00000090856
AA Change: Q3050R
SMART Domains Protein: ENSMUSP00000088369
Gene: ENSMUSG00000041991
AA Change: Q3050R

DomainStartEndE-ValueType
Pfam:S_100 4 47 4.8e-15 PFAM
Blast:EFh 53 81 6e-9 BLAST
internal_repeat_5 95 129 7.19e-7 PROSPERO
low complexity region 135 155 N/A INTRINSIC
low complexity region 157 168 N/A INTRINSIC
low complexity region 183 197 N/A INTRINSIC
low complexity region 200 246 N/A INTRINSIC
low complexity region 255 287 N/A INTRINSIC
internal_repeat_2 288 341 5.7e-19 PROSPERO
internal_repeat_1 291 354 5.27e-23 PROSPERO
internal_repeat_3 301 355 9.03e-17 PROSPERO
internal_repeat_5 309 343 7.19e-7 PROSPERO
low complexity region 358 379 N/A INTRINSIC
low complexity region 394 415 N/A INTRINSIC
low complexity region 421 498 N/A INTRINSIC
low complexity region 501 523 N/A INTRINSIC
low complexity region 527 593 N/A INTRINSIC
low complexity region 598 675 N/A INTRINSIC
low complexity region 679 713 N/A INTRINSIC
low complexity region 723 764 N/A INTRINSIC
low complexity region 769 846 N/A INTRINSIC
low complexity region 849 871 N/A INTRINSIC
low complexity region 875 941 N/A INTRINSIC
low complexity region 946 1023 N/A INTRINSIC
low complexity region 1027 1061 N/A INTRINSIC
low complexity region 1084 1112 N/A INTRINSIC
low complexity region 1117 1194 N/A INTRINSIC
low complexity region 1197 1219 N/A INTRINSIC
low complexity region 1223 1289 N/A INTRINSIC
low complexity region 1294 1371 N/A INTRINSIC
low complexity region 1375 1409 N/A INTRINSIC
low complexity region 1419 1460 N/A INTRINSIC
low complexity region 1465 1542 N/A INTRINSIC
low complexity region 1545 1567 N/A INTRINSIC
low complexity region 1571 1637 N/A INTRINSIC
low complexity region 1642 1719 N/A INTRINSIC
low complexity region 1723 1757 N/A INTRINSIC
low complexity region 1767 1808 N/A INTRINSIC
low complexity region 1813 1890 N/A INTRINSIC
low complexity region 1893 1915 N/A INTRINSIC
low complexity region 1919 1985 N/A INTRINSIC
low complexity region 1990 2067 N/A INTRINSIC
low complexity region 2071 2105 N/A INTRINSIC
low complexity region 2115 2156 N/A INTRINSIC
low complexity region 2161 2238 N/A INTRINSIC
low complexity region 2242 2327 N/A INTRINSIC
low complexity region 2332 2409 N/A INTRINSIC
low complexity region 2413 2447 N/A INTRINSIC
low complexity region 2457 2498 N/A INTRINSIC
low complexity region 2503 2580 N/A INTRINSIC
low complexity region 2583 2605 N/A INTRINSIC
low complexity region 2609 2675 N/A INTRINSIC
low complexity region 2680 2757 N/A INTRINSIC
low complexity region 2761 2795 N/A INTRINSIC
low complexity region 2805 2846 N/A INTRINSIC
low complexity region 2851 2896 N/A INTRINSIC
internal_repeat_4 2897 2968 4.19e-13 PROSPERO
internal_repeat_3 2901 2955 9.03e-17 PROSPERO
internal_repeat_2 2920 2967 5.7e-19 PROSPERO
low complexity region 2969 2985 N/A INTRINSIC
low complexity region 3016 3034 N/A INTRINSIC
internal_repeat_1 3039 3101 5.27e-23 PROSPERO
internal_repeat_4 3045 3103 4.19e-13 PROSPERO
low complexity region 3140 3153 N/A INTRINSIC
low complexity region 3163 3174 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000093774
AA Change: Q3227R
SMART Domains Protein: ENSMUSP00000091288
Gene: ENSMUSG00000041991
AA Change: Q3227R

DomainStartEndE-ValueType
Pfam:S_100 4 46 3.1e-17 PFAM
Blast:EFh 53 81 6e-9 BLAST
internal_repeat_5 95 129 5.9e-7 PROSPERO
low complexity region 135 155 N/A INTRINSIC
low complexity region 157 168 N/A INTRINSIC
low complexity region 183 197 N/A INTRINSIC
low complexity region 200 246 N/A INTRINSIC
low complexity region 255 287 N/A INTRINSIC
internal_repeat_2 288 341 3.49e-19 PROSPERO
internal_repeat_1 291 354 2.93e-23 PROSPERO
internal_repeat_3 301 355 5.83e-17 PROSPERO
internal_repeat_5 309 343 5.9e-7 PROSPERO
low complexity region 358 379 N/A INTRINSIC
low complexity region 394 415 N/A INTRINSIC
low complexity region 421 498 N/A INTRINSIC
low complexity region 501 523 N/A INTRINSIC
low complexity region 527 593 N/A INTRINSIC
low complexity region 598 675 N/A INTRINSIC
low complexity region 679 713 N/A INTRINSIC
low complexity region 723 764 N/A INTRINSIC
low complexity region 769 846 N/A INTRINSIC
low complexity region 849 871 N/A INTRINSIC
low complexity region 875 941 N/A INTRINSIC
low complexity region 946 1023 N/A INTRINSIC
low complexity region 1027 1061 N/A INTRINSIC
low complexity region 1084 1112 N/A INTRINSIC
low complexity region 1117 1194 N/A INTRINSIC
low complexity region 1197 1219 N/A INTRINSIC
low complexity region 1223 1289 N/A INTRINSIC
low complexity region 1294 1371 N/A INTRINSIC
low complexity region 1375 1409 N/A INTRINSIC
low complexity region 1419 1460 N/A INTRINSIC
low complexity region 1465 1542 N/A INTRINSIC
low complexity region 1545 1567 N/A INTRINSIC
low complexity region 1571 1637 N/A INTRINSIC
low complexity region 1642 1719 N/A INTRINSIC
low complexity region 1723 1757 N/A INTRINSIC
low complexity region 1767 1808 N/A INTRINSIC
low complexity region 1813 1890 N/A INTRINSIC
low complexity region 1893 1915 N/A INTRINSIC
low complexity region 1919 1985 N/A INTRINSIC
low complexity region 1990 2067 N/A INTRINSIC
low complexity region 2071 2105 N/A INTRINSIC
low complexity region 2115 2156 N/A INTRINSIC
low complexity region 2161 2238 N/A INTRINSIC
low complexity region 2242 2276 N/A INTRINSIC
low complexity region 2286 2327 N/A INTRINSIC
low complexity region 2332 2409 N/A INTRINSIC
low complexity region 2412 2434 N/A INTRINSIC
low complexity region 2438 2504 N/A INTRINSIC
low complexity region 2509 2586 N/A INTRINSIC
low complexity region 2590 2624 N/A INTRINSIC
low complexity region 2634 2675 N/A INTRINSIC
low complexity region 2680 2757 N/A INTRINSIC
low complexity region 2760 2782 N/A INTRINSIC
low complexity region 2786 2852 N/A INTRINSIC
low complexity region 2857 2934 N/A INTRINSIC
low complexity region 2938 2972 N/A INTRINSIC
low complexity region 2982 3023 N/A INTRINSIC
low complexity region 3028 3073 N/A INTRINSIC
internal_repeat_4 3074 3145 2.96e-13 PROSPERO
internal_repeat_3 3078 3132 5.83e-17 PROSPERO
internal_repeat_2 3097 3144 3.49e-19 PROSPERO
low complexity region 3146 3162 N/A INTRINSIC
low complexity region 3193 3211 N/A INTRINSIC
internal_repeat_1 3216 3278 2.93e-23 PROSPERO
internal_repeat_4 3222 3280 2.96e-13 PROSPERO
low complexity region 3317 3330 N/A INTRINSIC
low complexity region 3340 3351 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr6 C T 10: 89,714,979 V318I probably benign Het
Adam29 A G 8: 55,872,624 I265T probably benign Het
AI464131 T C 4: 41,498,812 T273A probably benign Het
Arcn1 T C 9: 44,743,962 T501A possibly damaging Het
B3gntl1 A T 11: 121,630,864 F166I possibly damaging Het
Brap T C 5: 121,684,461 S467P possibly damaging Het
Cenpb A G 2: 131,178,402 V492A unknown Het
Ces1b C A 8: 93,060,320 G477V probably damaging Het
Ces1b C T 8: 93,060,321 G477R probably damaging Het
Cfap65 T C 1: 74,903,223 K1724R probably benign Het
Chrd A T 16: 20,734,520 Q182L probably benign Het
Chrnb2 T C 3: 89,757,150 T486A probably benign Het
Col25a1 A T 3: 130,560,817 probably null Het
Col4a1 A G 8: 11,245,916 Y101H unknown Het
Crybg1 T C 10: 44,003,432 T587A probably damaging Het
Ctnnal1 T A 4: 56,835,374 N301I possibly damaging Het
Cyp2f2 A T 7: 27,132,570 N417Y probably damaging Het
Dnah6 T A 6: 73,032,563 E3800D possibly damaging Het
Ehmt2 C A 17: 34,908,513 T906K probably damaging Het
Fbxo15 A G 18: 84,960,075 H183R possibly damaging Het
Fgl1 T A 8: 41,197,331 K194* probably null Het
Fxr1 G A 3: 34,054,281 V314I possibly damaging Het
Ier5 G A 1: 155,098,970 A154V probably benign Het
Igkc T G 6: 70,726,518 L28V Het
Kcnh1 G A 1: 192,221,414 G54D probably damaging Het
Kcnn1 C T 8: 70,852,653 probably null Het
Kif1bp C T 10: 62,559,712 D384N possibly damaging Het
Klra2 T A 6: 131,220,235 N234I possibly damaging Het
Krtap4-9 T C 11: 99,785,628 I125T unknown Het
Lrig2 T C 3: 104,461,677 T897A probably benign Het
Lyve1 G T 7: 110,853,792 T199K probably damaging Het
Napa A G 7: 16,112,626 D113G possibly damaging Het
Neurog1 GGTG GGTGTG 13: 56,251,285 probably null Het
Nf1 T A 11: 79,547,138 H91Q probably damaging Het
Olfr1205 T C 2: 88,831,912 M265T probably benign Het
Olfr180 T A 16: 58,915,885 Y252F probably damaging Het
Olfr594 A T 7: 103,220,239 N174Y probably benign Het
Olfr732 A G 14: 50,281,779 I158T probably benign Het
Olfr828 A G 9: 18,815,623 S224P probably damaging Het
Pccb A T 9: 100,985,167 Y455* probably null Het
Pdk2 A T 11: 95,032,513 I95N probably damaging Het
Pik3c2g G A 6: 139,768,710 R196H Het
Pkd1l2 A G 8: 116,999,921 L2282P probably damaging Het
Plppr2 TCGCC TC 9: 21,944,431 probably benign Het
Prdm1 A T 10: 44,439,753 S796T probably benign Het
Rb1 A G 14: 73,265,560 F424L probably damaging Het
Retreg3 A G 11: 101,102,026 L190P probably damaging Het
Rffl A G 11: 82,810,038 Y321H probably damaging Het
Rlbp1 A G 7: 79,375,956 Y246H probably damaging Het
Rock2 T A 12: 16,965,654 probably benign Het
Slc17a3 C A 13: 23,855,592 C244* probably null Het
Snapc1 T C 12: 73,975,038 S304P probably benign Het
Sp9 T C 2: 73,273,675 L191P probably damaging Het
Spag17 A T 3: 99,982,422 E202D probably benign Het
Ss18 A G 18: 14,627,287 *419R probably null Het
Tacc2 A G 7: 130,674,691 E1824G possibly damaging Het
Tfap2a A T 13: 40,717,353 L353Q probably damaging Het
Ugt3a2 A G 15: 9,367,259 I363V possibly damaging Het
Vmn1r158 A G 7: 22,790,350 C145R probably damaging Het
Vmn1r23 A T 6: 57,926,367 I142K probably damaging Het
Vmn2r15 A T 5: 109,287,008 I610N probably benign Het
Wdr60 A G 12: 116,229,614 S573P probably damaging Het
Yy1 CGGCGACCACGGCGGCGGCGGGGGCG CGGCG 12: 108,793,580 probably benign Het
Zbtb7c T C 18: 76,137,119 Y93H probably damaging Het
Zfp62 A G 11: 49,216,411 N443S probably damaging Het
Other mutations in Hrnr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00848:Hrnr APN 3 93322897 missense unknown
IGL02326:Hrnr APN 3 93323745 missense unknown
IGL03030:Hrnr APN 3 93320601 missense possibly damaging 0.91
IGL03281:Hrnr APN 3 93322851 missense probably benign 0.04
R0140:Hrnr UTSW 3 93331493 nonsense probably null
R0709:Hrnr UTSW 3 93332508 missense unknown
R1179:Hrnr UTSW 3 93332543 missense unknown
R1528:Hrnr UTSW 3 93322794 missense possibly damaging 0.56
R1640:Hrnr UTSW 3 93332516 missense unknown
R1987:Hrnr UTSW 3 93332604 missense unknown
R1988:Hrnr UTSW 3 93332604 missense unknown
R3846:Hrnr UTSW 3 93332157 missense unknown
R3871:Hrnr UTSW 3 93331874 missense unknown
R3938:Hrnr UTSW 3 93322855 missense probably benign 0.35
R4569:Hrnr UTSW 3 93323568 missense unknown
R4690:Hrnr UTSW 3 93323652 missense unknown
R4761:Hrnr UTSW 3 93322755 missense probably damaging 0.96
R5182:Hrnr UTSW 3 93332143 missense unknown
R5292:Hrnr UTSW 3 93331892 missense unknown
R5739:Hrnr UTSW 3 93323129 missense unknown
R5845:Hrnr UTSW 3 93332637 missense unknown
R5994:Hrnr UTSW 3 93332300 missense unknown
R6169:Hrnr UTSW 3 93325755 nonsense probably null
R6216:Hrnr UTSW 3 93332162 missense unknown
R6256:Hrnr UTSW 3 93322611 missense probably damaging 1.00
R6670:Hrnr UTSW 3 93331885 missense unknown
R6790:Hrnr UTSW 3 93329075 missense unknown
R6936:Hrnr UTSW 3 93332360 missense unknown
R7049:Hrnr UTSW 3 93323154 nonsense probably null
R7358:Hrnr UTSW 3 93323141 nonsense probably null
R7383:Hrnr UTSW 3 93331791 missense unknown
R7724:Hrnr UTSW 3 93323016 missense unknown
R7762:Hrnr UTSW 3 93332199 missense unknown
R7945:Hrnr UTSW 3 93332199 missense unknown
R8086:Hrnr UTSW 3 93323421 missense unknown
R8115:Hrnr UTSW 3 93323732 missense unknown
R8383:Hrnr UTSW 3 93332346 missense unknown
R8685:Hrnr UTSW 3 93322898 missense unknown
Predicted Primers PCR Primer
(F):5'- TGTTCTGGCTTTGGTAACCAAG -3'
(R):5'- CCAGGACTAAAGGACTGACATG -3'

Sequencing Primer
(F):5'- GGCTTTGGTAACCAAGTATCTAGACC -3'
(R):5'- CATGAACCAGACCCATATTGTTCTG -3'
Posted On2021-04-30