Incidental Mutation 'R8809:Lrig2'
ID672258
Institutional Source Beutler Lab
Gene Symbol Lrig2
Ensembl Gene ENSMUSG00000032913
Gene Nameleucine-rich repeats and immunoglobulin-like domains 2
Synonyms4632419I10Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8809 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location104396418-104511918 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 104461677 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 897 (T897A)
Ref Sequence ENSEMBL: ENSMUSP00000035999 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046316] [ENSMUST00000198332] [ENSMUST00000199070]
Predicted Effect probably benign
Transcript: ENSMUST00000046316
AA Change: T897A

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000035999
Gene: ENSMUSG00000032913
AA Change: T897A

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
low complexity region 68 82 N/A INTRINSIC
LRR 118 141 3.56e2 SMART
LRR 142 165 1.81e2 SMART
LRR 167 188 1.31e0 SMART
LRR 213 236 1.41e0 SMART
LRR 237 260 4.98e-1 SMART
LRR 261 284 1.49e1 SMART
LRR 285 308 1.62e0 SMART
LRR 309 332 2.14e0 SMART
LRR_TYP 333 356 2.2e-2 SMART
LRR 357 383 9.22e0 SMART
LRR 384 407 2.17e-1 SMART
LRR_TYP 408 431 3.95e-4 SMART
LRRCT 442 492 3.62e-8 SMART
IG 503 598 2.19e-9 SMART
IGc2 613 681 1.94e-10 SMART
IGc2 707 772 3.2e-11 SMART
transmembrane domain 805 827 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000198332
AA Change: T890A

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000142540
Gene: ENSMUSG00000032913
AA Change: T890A

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
low complexity region 68 82 N/A INTRINSIC
LRR 118 141 3.56e2 SMART
LRR 142 165 1.81e2 SMART
LRR 167 188 1.31e0 SMART
LRR 213 236 1.41e0 SMART
LRR 237 260 4.98e-1 SMART
LRR 261 284 1.49e1 SMART
LRR 285 308 1.62e0 SMART
LRR 309 332 2.14e0 SMART
LRR_TYP 333 356 2.2e-2 SMART
LRR 357 383 9.22e0 SMART
LRR 384 407 2.17e-1 SMART
LRR_TYP 408 431 3.95e-4 SMART
LRRCT 442 492 3.62e-8 SMART
IG 503 598 2.19e-9 SMART
IGc2 613 681 1.94e-10 SMART
IGc2 707 772 3.2e-11 SMART
transmembrane domain 805 827 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000199070
AA Change: T532A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000142373
Gene: ENSMUSG00000032913
AA Change: T532A

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
LRRCT 84 134 1.8e-10 SMART
IG 145 240 9.2e-12 SMART
IGc2 255 323 8.1e-13 SMART
IGc2 349 414 1.3e-13 SMART
transmembrane domain 447 469 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000199180
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transmembrane protein containing leucine-rich repeats and immunoglobulin-like domains. The encoded protein promotes epidermal growth factor signalling, resulting in increased proliferation. Its expression in the cytoplasm of glioma cells is correlated with poor survival. Mutations in this gene can cause urofacial syndrome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced susceptibility to PDGFB-induced glioma and premature death due to illness with reduced body weight, letahrgy, hackled fur, crouched posture and increased inflammatory response. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr6 C T 10: 89,714,979 V318I probably benign Het
Adam29 A G 8: 55,872,624 I265T probably benign Het
AI464131 T C 4: 41,498,812 T273A probably benign Het
Arcn1 T C 9: 44,743,962 T501A possibly damaging Het
B3gntl1 A T 11: 121,630,864 F166I possibly damaging Het
Brap T C 5: 121,684,461 S467P possibly damaging Het
Cenpb A G 2: 131,178,402 V492A unknown Het
Ces1b C A 8: 93,060,320 G477V probably damaging Het
Ces1b C T 8: 93,060,321 G477R probably damaging Het
Cfap65 T C 1: 74,903,223 K1724R probably benign Het
Chrd A T 16: 20,734,520 Q182L probably benign Het
Chrnb2 T C 3: 89,757,150 T486A probably benign Het
Col25a1 A T 3: 130,560,817 probably null Het
Col4a1 A G 8: 11,245,916 Y101H unknown Het
Crybg1 T C 10: 44,003,432 T587A probably damaging Het
Ctnnal1 T A 4: 56,835,374 N301I possibly damaging Het
Cyp2f2 A T 7: 27,132,570 N417Y probably damaging Het
Dnah6 T A 6: 73,032,563 E3800D possibly damaging Het
Ehmt2 C A 17: 34,908,513 T906K probably damaging Het
Fbxo15 A G 18: 84,960,075 H183R possibly damaging Het
Fgl1 T A 8: 41,197,331 K194* probably null Het
Fxr1 G A 3: 34,054,281 V314I possibly damaging Het
Hrnr A G 3: 93,332,136 Q3227R unknown Het
Ier5 G A 1: 155,098,970 A154V probably benign Het
Igkc T G 6: 70,726,518 L28V Het
Kcnh1 G A 1: 192,221,414 G54D probably damaging Het
Kcnn1 C T 8: 70,852,653 probably null Het
Kif1bp C T 10: 62,559,712 D384N possibly damaging Het
Klra2 T A 6: 131,220,235 N234I possibly damaging Het
Krtap4-9 T C 11: 99,785,628 I125T unknown Het
Lyve1 G T 7: 110,853,792 T199K probably damaging Het
Napa A G 7: 16,112,626 D113G possibly damaging Het
Neurog1 GGTG GGTGTG 13: 56,251,285 probably null Het
Nf1 T A 11: 79,547,138 H91Q probably damaging Het
Olfr1205 T C 2: 88,831,912 M265T probably benign Het
Olfr180 T A 16: 58,915,885 Y252F probably damaging Het
Olfr594 A T 7: 103,220,239 N174Y probably benign Het
Olfr732 A G 14: 50,281,779 I158T probably benign Het
Olfr828 A G 9: 18,815,623 S224P probably damaging Het
Pccb A T 9: 100,985,167 Y455* probably null Het
Pdk2 A T 11: 95,032,513 I95N probably damaging Het
Pik3c2g G A 6: 139,768,710 R196H Het
Pkd1l2 A G 8: 116,999,921 L2282P probably damaging Het
Plppr2 TCGCC TC 9: 21,944,431 probably benign Het
Prdm1 A T 10: 44,439,753 S796T probably benign Het
Rb1 A G 14: 73,265,560 F424L probably damaging Het
Retreg3 A G 11: 101,102,026 L190P probably damaging Het
Rffl A G 11: 82,810,038 Y321H probably damaging Het
Rlbp1 A G 7: 79,375,956 Y246H probably damaging Het
Rock2 T A 12: 16,965,654 probably benign Het
Slc17a3 C A 13: 23,855,592 C244* probably null Het
Snapc1 T C 12: 73,975,038 S304P probably benign Het
Sp9 T C 2: 73,273,675 L191P probably damaging Het
Spag17 A T 3: 99,982,422 E202D probably benign Het
Ss18 A G 18: 14,627,287 *419R probably null Het
Tacc2 A G 7: 130,674,691 E1824G possibly damaging Het
Tfap2a A T 13: 40,717,353 L353Q probably damaging Het
Ugt3a2 A G 15: 9,367,259 I363V possibly damaging Het
Vmn1r158 A G 7: 22,790,350 C145R probably damaging Het
Vmn1r23 A T 6: 57,926,367 I142K probably damaging Het
Vmn2r15 A T 5: 109,287,008 I610N probably benign Het
Wdr60 A G 12: 116,229,614 S573P probably damaging Het
Yy1 CGGCGACCACGGCGGCGGCGGGGGCG CGGCG 12: 108,793,580 probably benign Het
Zbtb7c T C 18: 76,137,119 Y93H probably damaging Het
Zfp62 A G 11: 49,216,411 N443S probably damaging Het
Other mutations in Lrig2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00657:Lrig2 APN 3 104467171 missense probably damaging 0.99
IGL00715:Lrig2 APN 3 104463948 missense probably damaging 1.00
IGL01105:Lrig2 APN 3 104464168 nonsense probably null
IGL01767:Lrig2 APN 3 104491545 missense probably benign 0.12
IGL02080:Lrig2 APN 3 104464124 missense probably damaging 1.00
IGL02088:Lrig2 APN 3 104467108 missense probably damaging 1.00
IGL02967:Lrig2 APN 3 104494196 intron probably benign
IGL03024:Lrig2 APN 3 104494073 missense probably damaging 1.00
IGL03079:Lrig2 APN 3 104490971 missense probably damaging 0.98
IGL03085:Lrig2 APN 3 104467259 missense probably damaging 1.00
IGL03162:Lrig2 APN 3 104464297 missense probably damaging 1.00
Belladonna UTSW 3 104467366 splice site probably benign
R0414:Lrig2 UTSW 3 104494056 critical splice donor site probably null
R0866:Lrig2 UTSW 3 104464275 missense probably benign 0.00
R1184:Lrig2 UTSW 3 104490911 missense possibly damaging 0.94
R1524:Lrig2 UTSW 3 104463876 missense probably benign 0.38
R1606:Lrig2 UTSW 3 104480107 critical splice donor site probably null
R1672:Lrig2 UTSW 3 104491812 missense probably damaging 1.00
R1701:Lrig2 UTSW 3 104494677 missense probably benign 0.02
R1778:Lrig2 UTSW 3 104467366 splice site probably benign
R2034:Lrig2 UTSW 3 104494092 missense probably benign
R2100:Lrig2 UTSW 3 104511630 missense possibly damaging 0.76
R2186:Lrig2 UTSW 3 104468598 missense probably benign 0.00
R3778:Lrig2 UTSW 3 104457961 missense probably benign
R3977:Lrig2 UTSW 3 104457844 missense probably damaging 1.00
R4119:Lrig2 UTSW 3 104467195 missense probably benign 0.00
R4210:Lrig2 UTSW 3 104467304 missense probably benign 0.00
R4612:Lrig2 UTSW 3 104462783 missense probably damaging 1.00
R4872:Lrig2 UTSW 3 104491526 missense possibly damaging 0.66
R5020:Lrig2 UTSW 3 104457901 missense possibly damaging 0.71
R5499:Lrig2 UTSW 3 104461557 missense probably benign 0.00
R5687:Lrig2 UTSW 3 104464072 splice site probably null
R5718:Lrig2 UTSW 3 104468615 nonsense probably null
R5886:Lrig2 UTSW 3 104462698 missense probably benign 0.01
R5921:Lrig2 UTSW 3 104462754 nonsense probably null
R6434:Lrig2 UTSW 3 104491547 missense possibly damaging 0.91
R6468:Lrig2 UTSW 3 104467193 missense probably damaging 1.00
R6513:Lrig2 UTSW 3 104465729 missense probably damaging 1.00
R6675:Lrig2 UTSW 3 104457935 missense probably benign 0.35
R7243:Lrig2 UTSW 3 104497567 splice site probably null
R7395:Lrig2 UTSW 3 104497520 missense probably benign 0.00
R7444:Lrig2 UTSW 3 104497513 nonsense probably null
R7514:Lrig2 UTSW 3 104465760 missense probably damaging 1.00
R7751:Lrig2 UTSW 3 104494669 nonsense probably null
R8720:Lrig2 UTSW 3 104511682 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTAGCAGCATCTTGGGGAGG -3'
(R):5'- GGATCCCTTGGTTGAAATTTAGTCTC -3'

Sequencing Primer
(F):5'- GATGTGACAAAAACGTCTCCTTGG -3'
(R):5'- TTCAAGAGTATAGGCTCTGAAGC -3'
Posted On2021-04-30