Incidental Mutation 'R8809:Pik3c2g'
ID672268
Institutional Source Beutler Lab
Gene Symbol Pik3c2g
Ensembl Gene ENSMUSG00000030228
Gene Namephosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 gamma
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.085) question?
Stock #R8809 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location139587221-139969284 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 139768710 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 196 (R196H)
Ref Sequence ENSEMBL: ENSMUSP00000151281 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111868] [ENSMUST00000218528]
Predicted Effect
SMART Domains Protein: ENSMUSP00000107499
Gene: ENSMUSG00000030228
AA Change: R314H

DomainStartEndE-ValueType
SCOP:d1e8xa2 1 83 4e-16 SMART
PI3Ka 103 288 7.6e-29 SMART
PI3Kc 375 637 2.11e-109 SMART
PX 661 765 1.24e-21 SMART
C2 800 897 1.34e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187069
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191013
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the phosphoinositide 3-kinase (PI3K) family. PI3-kinases play roles in signaling pathways involved in cell proliferation, oncogenic transformation, cell survival, cell migration, and intracellular protein trafficking. This protein contains a lipid kinase catalytic domain as well as a C-terminal C2 domain, a characteristic of class II PI3-kinases. C2 domains act as calcium-dependent phospholipid binding motifs that mediate translocation of proteins to membranes, and may also mediate protein-protein interactions. This gene may play a role in several diseases, including type II diabetes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous for a knock-out allelel exhibit reduced liver glucogen accumulation, hyperlipidemia, adiposity and insulin resistance with age or after consumption of a high-fat diet. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr6 C T 10: 89,714,979 V318I probably benign Het
Adam29 A G 8: 55,872,624 I265T probably benign Het
AI464131 T C 4: 41,498,812 T273A probably benign Het
Arcn1 T C 9: 44,743,962 T501A possibly damaging Het
B3gntl1 A T 11: 121,630,864 F166I possibly damaging Het
Brap T C 5: 121,684,461 S467P possibly damaging Het
Cenpb A G 2: 131,178,402 V492A unknown Het
Ces1b C A 8: 93,060,320 G477V probably damaging Het
Ces1b C T 8: 93,060,321 G477R probably damaging Het
Cfap65 T C 1: 74,903,223 K1724R probably benign Het
Chrd A T 16: 20,734,520 Q182L probably benign Het
Chrnb2 T C 3: 89,757,150 T486A probably benign Het
Col25a1 A T 3: 130,560,817 probably null Het
Col4a1 A G 8: 11,245,916 Y101H unknown Het
Crybg1 T C 10: 44,003,432 T587A probably damaging Het
Ctnnal1 T A 4: 56,835,374 N301I possibly damaging Het
Cyp2f2 A T 7: 27,132,570 N417Y probably damaging Het
Dnah6 T A 6: 73,032,563 E3800D possibly damaging Het
Ehmt2 C A 17: 34,908,513 T906K probably damaging Het
Fbxo15 A G 18: 84,960,075 H183R possibly damaging Het
Fgl1 T A 8: 41,197,331 K194* probably null Het
Fxr1 G A 3: 34,054,281 V314I possibly damaging Het
Hrnr A G 3: 93,332,136 Q3227R unknown Het
Ier5 G A 1: 155,098,970 A154V probably benign Het
Igkc T G 6: 70,726,518 L28V Het
Kcnh1 G A 1: 192,221,414 G54D probably damaging Het
Kcnn1 C T 8: 70,852,653 probably null Het
Kif1bp C T 10: 62,559,712 D384N possibly damaging Het
Klra2 T A 6: 131,220,235 N234I possibly damaging Het
Krtap4-9 T C 11: 99,785,628 I125T unknown Het
Lrig2 T C 3: 104,461,677 T897A probably benign Het
Lyve1 G T 7: 110,853,792 T199K probably damaging Het
Napa A G 7: 16,112,626 D113G possibly damaging Het
Neurog1 GGTG GGTGTG 13: 56,251,285 probably null Het
Nf1 T A 11: 79,547,138 H91Q probably damaging Het
Olfr1205 T C 2: 88,831,912 M265T probably benign Het
Olfr180 T A 16: 58,915,885 Y252F probably damaging Het
Olfr594 A T 7: 103,220,239 N174Y probably benign Het
Olfr732 A G 14: 50,281,779 I158T probably benign Het
Olfr828 A G 9: 18,815,623 S224P probably damaging Het
Pccb A T 9: 100,985,167 Y455* probably null Het
Pdk2 A T 11: 95,032,513 I95N probably damaging Het
Pkd1l2 A G 8: 116,999,921 L2282P probably damaging Het
Plppr2 TCGCC TC 9: 21,944,431 probably benign Het
Prdm1 A T 10: 44,439,753 S796T probably benign Het
Rb1 A G 14: 73,265,560 F424L probably damaging Het
Retreg3 A G 11: 101,102,026 L190P probably damaging Het
Rffl A G 11: 82,810,038 Y321H probably damaging Het
Rlbp1 A G 7: 79,375,956 Y246H probably damaging Het
Rock2 T A 12: 16,965,654 probably benign Het
Slc17a3 C A 13: 23,855,592 C244* probably null Het
Snapc1 T C 12: 73,975,038 S304P probably benign Het
Sp9 T C 2: 73,273,675 L191P probably damaging Het
Spag17 A T 3: 99,982,422 E202D probably benign Het
Ss18 A G 18: 14,627,287 *419R probably null Het
Tacc2 A G 7: 130,674,691 E1824G possibly damaging Het
Tfap2a A T 13: 40,717,353 L353Q probably damaging Het
Ugt3a2 A G 15: 9,367,259 I363V possibly damaging Het
Vmn1r158 A G 7: 22,790,350 C145R probably damaging Het
Vmn1r23 A T 6: 57,926,367 I142K probably damaging Het
Vmn2r15 A T 5: 109,287,008 I610N probably benign Het
Wdr60 A G 12: 116,229,614 S573P probably damaging Het
Yy1 CGGCGACCACGGCGGCGGCGGGGGCG CGGCG 12: 108,793,580 probably benign Het
Zbtb7c T C 18: 76,137,119 Y93H probably damaging Het
Zfp62 A G 11: 49,216,411 N443S probably damaging Het
Other mutations in Pik3c2g
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Pik3c2g APN 6 139896125 missense probably damaging 1.00
IGL01355:Pik3c2g APN 6 139852857 missense probably damaging 0.98
IGL01579:Pik3c2g APN 6 139754741 nonsense probably null
IGL01580:Pik3c2g APN 6 139622516 missense probably damaging 0.99
IGL01587:Pik3c2g APN 6 139754741 nonsense probably null
IGL01813:Pik3c2g APN 6 139622409 missense possibly damaging 0.55
IGL02218:Pik3c2g APN 6 139860355 missense probably damaging 1.00
IGL02479:Pik3c2g APN 6 139918004 missense probably benign 0.40
IGL02480:Pik3c2g APN 6 139852800 missense probably damaging 1.00
IGL02721:Pik3c2g APN 6 139736973 missense probably benign 0.15
IGL02967:Pik3c2g APN 6 139967828 missense probably damaging 0.98
IGL03221:Pik3c2g APN 6 139772407 critical splice acceptor site probably null
FR4304:Pik3c2g UTSW 6 139635656 frame shift probably null
FR4340:Pik3c2g UTSW 6 139635656 frame shift probably null
FR4976:Pik3c2g UTSW 6 139635654 frame shift probably null
IGL02837:Pik3c2g UTSW 6 139626564 nonsense probably null
PIT4531001:Pik3c2g UTSW 6 139859370 missense
R0002:Pik3c2g UTSW 6 139768745 missense probably benign 0.08
R0081:Pik3c2g UTSW 6 139957793 missense probably benign 0.05
R0098:Pik3c2g UTSW 6 139662443 missense unknown
R0719:Pik3c2g UTSW 6 139629725 missense probably damaging 1.00
R0740:Pik3c2g UTSW 6 139633793 critical splice donor site probably null
R0837:Pik3c2g UTSW 6 139957699 splice site probably benign
R0840:Pik3c2g UTSW 6 139896072 missense probably damaging 1.00
R1306:Pik3c2g UTSW 6 139772428 missense probably benign
R1501:Pik3c2g UTSW 6 139844070 critical splice donor site probably null
R1591:Pik3c2g UTSW 6 139748178 missense probably benign 0.00
R1666:Pik3c2g UTSW 6 139635636 intron probably benign
R1907:Pik3c2g UTSW 6 139844042 missense probably damaging 1.00
R1970:Pik3c2g UTSW 6 139900386 critical splice donor site probably null
R1982:Pik3c2g UTSW 6 139622548 missense probably damaging 0.97
R2171:Pik3c2g UTSW 6 139855286 nonsense probably null
R2188:Pik3c2g UTSW 6 139852874 missense probably damaging 1.00
R3777:Pik3c2g UTSW 6 139622387 missense probably damaging 1.00
R3778:Pik3c2g UTSW 6 139622387 missense probably damaging 1.00
R3965:Pik3c2g UTSW 6 139855292 missense possibly damaging 0.90
R4076:Pik3c2g UTSW 6 139852863 missense probably damaging 1.00
R4078:Pik3c2g UTSW 6 139635610 intron probably benign
R4108:Pik3c2g UTSW 6 139730370 missense probably benign 0.00
R4461:Pik3c2g UTSW 6 139841681 intron probably benign
R4474:Pik3c2g UTSW 6 139633751 missense probably damaging 0.99
R4509:Pik3c2g UTSW 6 139720006 missense probably benign 0.25
R4646:Pik3c2g UTSW 6 139720018 missense probably benign 0.05
R4732:Pik3c2g UTSW 6 139935985 missense probably benign 0.28
R4733:Pik3c2g UTSW 6 139935985 missense probably benign 0.28
R4854:Pik3c2g UTSW 6 139768779 missense probably damaging 1.00
R4928:Pik3c2g UTSW 6 139967802 missense possibly damaging 0.88
R4959:Pik3c2g UTSW 6 139843931 missense possibly damaging 0.65
R4973:Pik3c2g UTSW 6 139843931 missense possibly damaging 0.65
R5032:Pik3c2g UTSW 6 139896202 missense probably benign 0.00
R5071:Pik3c2g UTSW 6 139720147 missense probably null 0.00
R5072:Pik3c2g UTSW 6 139720147 missense probably null 0.00
R5073:Pik3c2g UTSW 6 139720147 missense probably null 0.00
R5074:Pik3c2g UTSW 6 139720147 missense probably null 0.00
R5107:Pik3c2g UTSW 6 139635625 intron probably benign
R5186:Pik3c2g UTSW 6 139622018 missense probably damaging 1.00
R5253:Pik3c2g UTSW 6 139896257 critical splice donor site probably null
R5359:Pik3c2g UTSW 6 139622123 missense probably damaging 1.00
R5394:Pik3c2g UTSW 6 139720082 missense probably benign
R5417:Pik3c2g UTSW 6 139736943 missense probably benign
R5435:Pik3c2g UTSW 6 139715855 splice site probably null
R5580:Pik3c2g UTSW 6 139626533 missense probably damaging 0.99
R5664:Pik3c2g UTSW 6 139737007 missense probably damaging 0.98
R5908:Pik3c2g UTSW 6 139768710 missense
R5914:Pik3c2g UTSW 6 139622479 missense probably benign 0.00
R6046:Pik3c2g UTSW 6 139622139 missense probably damaging 0.96
R6046:Pik3c2g UTSW 6 139896792 missense probably damaging 1.00
R6298:Pik3c2g UTSW 6 139626563 missense probably damaging 1.00
R6382:Pik3c2g UTSW 6 139719998 missense possibly damaging 0.88
R6480:Pik3c2g UTSW 6 139730469 missense probably benign 0.27
R6917:Pik3c2g UTSW 6 139896173 missense probably benign 0.00
R6929:Pik3c2g UTSW 6 139957776 missense possibly damaging 0.67
R7022:Pik3c2g UTSW 6 139622063 missense possibly damaging 0.82
R7144:Pik3c2g UTSW 6 139629870 missense probably damaging 1.00
R7213:Pik3c2g UTSW 6 139860264 missense
R7215:Pik3c2g UTSW 6 139754863 missense
R7332:Pik3c2g UTSW 6 139896255 missense
R7357:Pik3c2g UTSW 6 139633793 critical splice donor site probably null
R7359:Pik3c2g UTSW 6 139967894 missense unknown
R7385:Pik3c2g UTSW 6 139855353 missense
R7455:Pik3c2g UTSW 6 139967917 missense unknown
R7651:Pik3c2g UTSW 6 139622072 missense possibly damaging 0.85
R7888:Pik3c2g UTSW 6 139896744 missense
R7923:Pik3c2g UTSW 6 139633793 critical splice donor site probably null
R7964:Pik3c2g UTSW 6 139882060 missense
R8005:Pik3c2g UTSW 6 139622069 missense probably benign 0.01
R8371:Pik3c2g UTSW 6 139936056 missense unknown
R8724:Pik3c2g UTSW 6 139967893 missense unknown
R8733:Pik3c2g UTSW 6 139768700 nonsense probably null
RF015:Pik3c2g UTSW 6 139754771 missense
RF032:Pik3c2g UTSW 6 139635658 frame shift probably null
X0024:Pik3c2g UTSW 6 139860258 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTATGCACTAGAATTTACTCTGTG -3'
(R):5'- GCAGTATAGCAGGTTAGTGATTTC -3'

Sequencing Primer
(F):5'- GGGGCATGTCTCCACCAAATATG -3'
(R):5'- CATGGGCTTGCAGTGGGAAC -3'
Posted On2021-04-30