Incidental Mutation 'R8809:Adam29'
ID672278
Institutional Source Beutler Lab
Gene Symbol Adam29
Ensembl Gene ENSMUSG00000046258
Gene Namea disintegrin and metallopeptidase domain 29
Synonyms
Accession Numbers

Genbank: NM_175939; MGI: 2676326

Is this an essential gene? Probably non essential (E-score: 0.087) question?
Stock #R8809 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location55870912-55906948 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 55872624 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 265 (I265T)
Ref Sequence ENSEMBL: ENSMUSP00000054292 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053441]
Predicted Effect probably benign
Transcript: ENSMUST00000053441
AA Change: I265T

PolyPhen 2 Score 0.297 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000054292
Gene: ENSMUSG00000046258
AA Change: I265T

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:Pep_M12B_propep 33 159 1.9e-17 PFAM
Pfam:Reprolysin_4 203 394 3.3e-10 PFAM
Pfam:Reprolysin_5 203 403 6.9e-15 PFAM
Pfam:Reprolysin 205 395 1.5e-48 PFAM
Pfam:Reprolysin_2 226 386 7.4e-11 PFAM
Pfam:Reprolysin_3 228 349 1.4e-11 PFAM
DISIN 412 487 4.26e-37 SMART
ACR 488 624 2.85e-58 SMART
low complexity region 642 651 N/A INTRINSIC
transmembrane domain 683 705 N/A INTRINSIC
low complexity region 713 746 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of a disintegrin and metalloprotease (ADAM) family of endoproteases that play important roles in various biological processes including cell signaling, adhesion and migration. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. [provided by RefSeq, May 2016]
Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr6 C T 10: 89,714,979 V318I probably benign Het
AI464131 T C 4: 41,498,812 T273A probably benign Het
Arcn1 T C 9: 44,743,962 T501A possibly damaging Het
B3gntl1 A T 11: 121,630,864 F166I possibly damaging Het
Brap T C 5: 121,684,461 S467P possibly damaging Het
Cenpb A G 2: 131,178,402 V492A unknown Het
Ces1b C A 8: 93,060,320 G477V probably damaging Het
Ces1b C T 8: 93,060,321 G477R probably damaging Het
Cfap65 T C 1: 74,903,223 K1724R probably benign Het
Chrd A T 16: 20,734,520 Q182L probably benign Het
Chrnb2 T C 3: 89,757,150 T486A probably benign Het
Col25a1 A T 3: 130,560,817 probably null Het
Col4a1 A G 8: 11,245,916 Y101H unknown Het
Crybg1 T C 10: 44,003,432 T587A probably damaging Het
Ctnnal1 T A 4: 56,835,374 N301I possibly damaging Het
Cyp2f2 A T 7: 27,132,570 N417Y probably damaging Het
Dnah6 T A 6: 73,032,563 E3800D possibly damaging Het
Ehmt2 C A 17: 34,908,513 T906K probably damaging Het
Fbxo15 A G 18: 84,960,075 H183R possibly damaging Het
Fgl1 T A 8: 41,197,331 K194* probably null Het
Fxr1 G A 3: 34,054,281 V314I possibly damaging Het
Hrnr A G 3: 93,332,136 Q3227R unknown Het
Ier5 G A 1: 155,098,970 A154V probably benign Het
Igkc T G 6: 70,726,518 L28V Het
Kcnh1 G A 1: 192,221,414 G54D probably damaging Het
Kcnn1 C T 8: 70,852,653 probably null Het
Kif1bp C T 10: 62,559,712 D384N possibly damaging Het
Klra2 T A 6: 131,220,235 N234I possibly damaging Het
Krtap4-9 T C 11: 99,785,628 I125T unknown Het
Lrig2 T C 3: 104,461,677 T897A probably benign Het
Lyve1 G T 7: 110,853,792 T199K probably damaging Het
Napa A G 7: 16,112,626 D113G possibly damaging Het
Neurog1 GGTG GGTGTG 13: 56,251,285 probably null Het
Nf1 T A 11: 79,547,138 H91Q probably damaging Het
Olfr1205 T C 2: 88,831,912 M265T probably benign Het
Olfr180 T A 16: 58,915,885 Y252F probably damaging Het
Olfr594 A T 7: 103,220,239 N174Y probably benign Het
Olfr732 A G 14: 50,281,779 I158T probably benign Het
Olfr828 A G 9: 18,815,623 S224P probably damaging Het
Pccb A T 9: 100,985,167 Y455* probably null Het
Pdk2 A T 11: 95,032,513 I95N probably damaging Het
Pik3c2g G A 6: 139,768,710 R196H Het
Pkd1l2 A G 8: 116,999,921 L2282P probably damaging Het
Plppr2 TCGCC TC 9: 21,944,431 probably benign Het
Prdm1 A T 10: 44,439,753 S796T probably benign Het
Rb1 A G 14: 73,265,560 F424L probably damaging Het
Retreg3 A G 11: 101,102,026 L190P probably damaging Het
Rffl A G 11: 82,810,038 Y321H probably damaging Het
Rlbp1 A G 7: 79,375,956 Y246H probably damaging Het
Rock2 T A 12: 16,965,654 probably benign Het
Slc17a3 C A 13: 23,855,592 C244* probably null Het
Snapc1 T C 12: 73,975,038 S304P probably benign Het
Sp9 T C 2: 73,273,675 L191P probably damaging Het
Spag17 A T 3: 99,982,422 E202D probably benign Het
Ss18 A G 18: 14,627,287 *419R probably null Het
Tacc2 A G 7: 130,674,691 E1824G possibly damaging Het
Tfap2a A T 13: 40,717,353 L353Q probably damaging Het
Ugt3a2 A G 15: 9,367,259 I363V possibly damaging Het
Vmn1r158 A G 7: 22,790,350 C145R probably damaging Het
Vmn1r23 A T 6: 57,926,367 I142K probably damaging Het
Vmn2r15 A T 5: 109,287,008 I610N probably benign Het
Wdr60 A G 12: 116,229,614 S573P probably damaging Het
Yy1 CGGCGACCACGGCGGCGGCGGGGGCG CGGCG 12: 108,793,580 probably benign Het
Zbtb7c T C 18: 76,137,119 Y93H probably damaging Het
Zfp62 A G 11: 49,216,411 N443S probably damaging Het
Other mutations in Adam29
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01305:Adam29 APN 8 55871844 missense probably benign 0.01
IGL01406:Adam29 APN 8 55871839 missense probably damaging 1.00
IGL01511:Adam29 APN 8 55871421 missense probably damaging 1.00
IGL01869:Adam29 APN 8 55871697 missense probably damaging 0.99
IGL01894:Adam29 APN 8 55871830 missense probably benign 0.00
IGL02023:Adam29 APN 8 55872484 missense probably benign 0.12
IGL02030:Adam29 APN 8 55872122 missense probably benign 0.35
IGL02071:Adam29 APN 8 55871554 missense possibly damaging 0.95
IGL02094:Adam29 APN 8 55871445 missense possibly damaging 0.48
IGL02108:Adam29 APN 8 55872311 missense probably damaging 0.98
IGL02125:Adam29 APN 8 55871939 nonsense probably null
IGL02330:Adam29 APN 8 55872363 missense probably benign 0.02
IGL02332:Adam29 APN 8 55871740 missense probably damaging 1.00
IGL02548:Adam29 APN 8 55872867 nonsense probably null
IGL02960:Adam29 APN 8 55872666 nonsense probably null
IGL03030:Adam29 APN 8 55873065 missense probably damaging 1.00
ANU22:Adam29 UTSW 8 55871844 missense probably benign 0.01
D4043:Adam29 UTSW 8 55872461 nonsense probably null
IGL02835:Adam29 UTSW 8 55873138 missense probably damaging 1.00
R0294:Adam29 UTSW 8 55873276 missense probably benign 0.25
R0449:Adam29 UTSW 8 55872681 missense probably benign 0.01
R0607:Adam29 UTSW 8 55873275 missense probably damaging 1.00
R0626:Adam29 UTSW 8 55871577 missense probably benign 0.24
R1296:Adam29 UTSW 8 55871719 nonsense probably null
R1752:Adam29 UTSW 8 55872274 missense probably damaging 0.98
R1930:Adam29 UTSW 8 55873089 missense probably damaging 1.00
R1931:Adam29 UTSW 8 55873089 missense probably damaging 1.00
R2397:Adam29 UTSW 8 55872898 missense probably benign 0.04
R2764:Adam29 UTSW 8 55871756 missense probably damaging 1.00
R4052:Adam29 UTSW 8 55872282 missense probably damaging 1.00
R4978:Adam29 UTSW 8 55871401 missense probably damaging 0.98
R5306:Adam29 UTSW 8 55871757 missense probably damaging 1.00
R6383:Adam29 UTSW 8 55871508 missense probably damaging 0.99
R6528:Adam29 UTSW 8 55872561 missense possibly damaging 0.93
R6579:Adam29 UTSW 8 55872744 missense probably damaging 1.00
R6707:Adam29 UTSW 8 55872100 missense probably damaging 1.00
R7076:Adam29 UTSW 8 55871659 missense probably damaging 1.00
R7099:Adam29 UTSW 8 55871404 missense probably benign 0.01
R7177:Adam29 UTSW 8 55872624 missense probably benign 0.30
R7320:Adam29 UTSW 8 55872714 missense possibly damaging 0.50
R7420:Adam29 UTSW 8 55872898 missense probably benign 0.04
R7438:Adam29 UTSW 8 55871574 missense probably damaging 0.99
R7476:Adam29 UTSW 8 55873195 missense probably damaging 0.97
R7524:Adam29 UTSW 8 55872360 missense probably damaging 1.00
R8066:Adam29 UTSW 8 55872668 missense probably benign 0.11
R8111:Adam29 UTSW 8 55871550 missense probably benign 0.00
R8221:Adam29 UTSW 8 55872428 missense probably benign 0.02
R8350:Adam29 UTSW 8 55872189 missense possibly damaging 0.89
R8353:Adam29 UTSW 8 55873161 missense possibly damaging 0.82
R8453:Adam29 UTSW 8 55873161 missense possibly damaging 0.82
R8723:Adam29 UTSW 8 55871478 missense probably damaging 1.00
R8752:Adam29 UTSW 8 55872293 nonsense probably null
X0011:Adam29 UTSW 8 55873168 missense probably benign 0.02
Z1177:Adam29 UTSW 8 55871496 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGCACGAAGGTTCAAAGTTC -3'
(R):5'- GGTGGACCCATACTAAAATTGTTG -3'

Sequencing Primer
(F):5'- CACGAAGGTTCAAAGTTCTGTCTATG -3'
(R):5'- GAATTAGTAGTGGTGGTGGATAAGAC -3'
Posted On2021-04-30